Busch Lab

ZMP

B2GTW7_DANRE

Ensembl ID:
ENSDARG00000075833
Description:
LOC560618 protein [Source:UniProtKB/TrEMBL;Acc:B2GTW7]
Human Orthologue:
LYVE1
Human Description:
lymphatic vessel endothelial hyaluronan receptor 1 [Source:HGNC Symbol;Acc:14687]
Mouse Orthologue:
Lyve1
Mouse Description:
lymphatic vessel endothelial hyaluronan receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2136348]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14763 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14763
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112109 Essential Splice Site 89 328 2 6
Genomic Location (Zv9):
Chromosome 7 (position 68723707)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66601728
GRCz11 7 66825376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACAAAGCACAGCTAGCAGAGGCTCAGAAACACGGCCTGGAGAMGTGCAG[G/T]TAAAACACTKCTCAATTCTGAAAARTCTGATCTGTTTAATGCGAGGATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27093
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112109 Nonsense 138 328 4 6
Genomic Location (Zv9):
Chromosome 7 (position 68726225)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66604246
GRCz11 7 66827894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAACAAGCCTGATTTATTTTTTATCTTTTTTTTTTTTTTTGTAGATTTT[G/T]AGACACAGGCTTCCATAAAGGTGCACCAAATGACAACCGGAAAGCCGATG
Associated Phenotype:
Not determined