Busch Lab

ZMP

si:ch211-14a17.3

Ensembl ID:
ENSDARG00000075831
ZFIN ID:
ZDB-GENE-070424-132
Human Orthologue:
SLC7A8
Human Description:
solute carrier family 7 (amino acid transporter, L-type), member 8 [Source:HGNC Symbol;Acc:11066]
Mouse Orthologue:
Slc7a8
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene [Source:MGI Symb

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa10767 Essential Splice Site Available for shipment Available now
sa1219 Nonsense Available for shipment Available now
sa20925 Essential Splice Site Available for shipment Available now
sa14212 Essential Splice Site Available for shipment Available now
sa20924 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10767
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010124 Essential Splice Site 50 531 2 11
Genomic Location (Zv9):
Chromosome 7 (position 25394393)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23956145
GRCz11 7 24227302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTATTTTAATTTACATTTCCAATACTCAACCTCTATGTTTTGTCATTTKC[A/T]GGTAACATCATTGGCTCTGGAATCTTTGTCAGCCCAAAGGGAGTGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1219
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010124 Nonsense 412 531 9 11
Genomic Location (Zv9):
Chromosome 7 (position 25381423)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23943175
GRCz11 7 24214332
KASP Assay ID:
554-1128.1 (used for ordering genotyping assays)
KASP Sequence:
ACCTCTTCTACGGTGTCACTGTTGCTGGGCAGATTGTGCTGCGGATTAAA[C/T]AACCAGATATGCACCGACCAATTAAAGTAAGAATTGCTAATGATAAAAWA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20925
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010124 Essential Splice Site 421 531 10 11
Genomic Location (Zv9):
Chromosome 7 (position 25380554)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23942306
GRCz11 7 24213463
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAGATTATTTTTTCCTTCAGATTGCTAACCTCTCTTTTACTCCTCAC[A/T]GATCAGTCTGGTGTGGCCTGTGATCTACCTGCTCTTCTGGGCCTTCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14212
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010124 Essential Splice Site 479 531 10 11
Genomic Location (Zv9):
Chromosome 7 (position 25380374)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23942126
GRCz11 7 24213283
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGGGCGTTTACTGGGACAACAAGCCCCAATGTTTCAATACATTTRTTG[G/A]TGAGTGGAATACAGTTCACACAYGTGTGGGACTTCATGATTGCWATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20924
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010124 Essential Splice Site 480 531 11 11
Genomic Location (Zv9):
Chromosome 7 (position 25379603)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23941355
GRCz11 7 24212512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATTATTGACGTATGACACGTGAACCAAATTCCTCTCTTTGTGTTTAC[A/T]GACAAGATGACATACCTGGGCCAGAAATTCTGTGTGGTGGTGTATCCAAT
Associated Phenotype:
Not determined