Busch Lab

ZMP

si:dkey-246l21.2

Ensembl ID:
ENSDARG00000075825
ZFIN ID:
ZDB-GENE-091204-65
Human Orthologue:
DLEC1
Human Description:
deleted in lung and esophageal cancer 1 [Source:HGNC Symbol;Acc:2899]
Mouse Orthologue:
Dlec1
Mouse Description:
deleted in lung and esophageal cancer 1 Gene [Source:MGI Symbol;Acc:MGI:2443671]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa44120 Nonsense Mutation detected in F1 DNA Not yet available
sa15793 Essential Splice Site Available for shipment Available now
sa18315 Nonsense Available for shipment Available now
sa37869 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8863 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16256 Essential Splice Site Available for shipment Available now
sa24479 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44120
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109223 Nonsense 82 1702 3 38
ENSDART00000143174 Nonsense 82 1701 3 38

The following transcripts of ENSDARG00000075825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20976300)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20223429
GRCz11 24 20367848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCTAAATTCTAATATTTCATGATTTCATTGTAGGTGCACAGTGAATA[C/A]AACAGACGTATTCAGAATGCTGATATGCTAGAGACACACATCATACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15793
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109223 Essential Splice Site 130 1702 4 38
ENSDART00000143174 Essential Splice Site 130 1701 4 38

The following transcripts of ENSDARG00000075825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20976042)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20223171
GRCz11 24 20367590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGTTTGTAGTGCTATGACTAAAAACACAGYATTAATTATTTTTCCATA[G/A]WAAAATCAGYTTTYAAGTGGTGTRTGGACAGTGGACTTTTGAGGAGCAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18315
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109223 Nonsense 325 1702 7 38
ENSDART00000143174 Nonsense 324 1701 7 38

The following transcripts of ENSDARG00000075825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20970549)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20217678
GRCz11 24 20362097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCGCCTATTTTCACTGCRAATCCACCAGTGATCTTCTTCAGTGACTAC[A/T]GAGTAGGACAAGTCTATGAGGTACAAAAGYAACTTATWTTGCATTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37869
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109223 Essential Splice Site 495 1702 11 38
ENSDART00000143174 Essential Splice Site 494 1701 11 38

The following transcripts of ENSDARG00000075825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20965049)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20212178
GRCz11 24 20356597
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCCCTCTATTTTCGGCCTTCACCCTGGACAGGCTACTGTCATAGAGG[T/C]GAGATATTATCTAGAGTGCATATTATGATGTGTATGCGCTGTTGTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8863
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109223 Essential Splice Site 1155 1702 26 38
ENSDART00000143174 Essential Splice Site 1154 1701 26 38

The following transcripts of ENSDARG00000075825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20953642)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20200771
GRCz11 24 20345190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTRCTTTCAMAAATWTGTGGGGGGATTATCAGGACAACCTCATATGCAAA[G/A]TATGTCASATTAAATTNNNNNATTAAATTCTAATGATTACATCATAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16256
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109223 Essential Splice Site 1156 1702 27 38
ENSDART00000143174 Essential Splice Site 1155 1701 27 38

The following transcripts of ENSDARG00000075825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20953538)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20200667
GRCz11 24 20345086
KASP Assay ID:
2261-8640.1 (used for ordering genotyping assays)
KASP Sequence:
AGCCTTTCTCAAATCAGACWGTCAATTCTGGWCAWTTTCTTACTTTTTNC[A/G]GGTTGGAGATCTAAATCCWACTCACATTCAYATGAAGAYRTCTGTGAGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8035
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109223 Nonsense 1234 1702 29 38
ENSDART00000143174 Nonsense 1233 1701 29 38

The following transcripts of ENSDARG00000075825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20951900)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20199029
GRCz11 24 20343448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
SAGATATCCGTMTGGACTGGGTGACCTACAACCTGGAGGCTGGAGACGGC[A/T]AGCTRATAGATCTGCTGCTTGCATGTGGTGAAYCTTTCCCTCTGAAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24479
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109223 Nonsense 1556 1702 35 38
ENSDART00000143174 Nonsense 1555 1701 35 38

The following transcripts of ENSDARG00000075825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20945124)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20192253
GRCz11 24 20336672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCTTCCCTTCTTTGCAGTGATGATGGAGGAAAAACTCTACAGTTT[C/T]AGGAGAACTTGACCATTCAGTACAGCAATAACAGCATACAGGTGCCTTTA
Associated Phenotype:
Not determined