Busch Lab

ZMP

si:ch211-79l20.4

Ensembl ID:
ENSDARG00000075824
ZFIN ID:
ZDB-GENE-100922-238
Human Orthologue:
KIAA1429
Human Description:
KIAA1429 [Source:HGNC Symbol;Acc:24500]
Mouse Orthologue:
1110037F02Rik
Mouse Description:
RIKEN cDNA 1110037F02 gene Gene [Source:MGI Symbol;Acc:MGI:1913435]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa22853 Nonsense Available for shipment Available now
sa17347 Nonsense Available for shipment Available now
sa36152 Nonsense Mutation detected in F1 DNA Not yet available
sa6434 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22853
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Nonsense 283 1835 8 23
ENSDART00000142215 Nonsense 284 1836 8 23
ENSDART00000142706 None None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28941590)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26817364
GRCz11 16 26690806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAACAAGTGTGTGATGTGTTATGTTTTCACCTTCAGGTGATGATGGATA[T/A]GAGCAGATATCCAGTGATGAGGAGGATTTAGAGAGTGGGGCTTTCAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17347
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Nonsense 506 1835 8 23
ENSDART00000142215 Nonsense 507 1836 8 23
ENSDART00000142706 None None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28942257)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26818031
GRCz11 16 26691473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACGTGCTGCGCTCCCTYGACAGCATCATCAGCGAGCCACAGGGCATC[G/T]ARGCTATGCTCAGAGACCGCCACCATCATGAKGATGATGGCACAAGCGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2886
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Nonsense 523 1835 8 23
ENSDART00000142215 Nonsense 524 1836 8 23
ENSDART00000142706 None None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28942310)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26818084
GRCz11 16 26691526
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTATGCTCAGAGACCGCCACCATCATGATGATGATGGCACAAGCGGGTA[T/A]CAGCGTCTGCTCGATCTGTTTCTATTGGACCAGACTGTTCGTGTCGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36152
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Nonsense 910 1835 11 23
ENSDART00000142215 Nonsense 911 1836 11 23
ENSDART00000142706 None None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28947164)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26822938
GRCz11 16 26696380
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAACATCTGACCTCAGTGATTTATATGTTTTTCAGAGCTCTCTAAGTG[G/A]TTGGAGCCACTTGAAAAATTACATTTCGATATCAGTGGCATTCCTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6434
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Essential Splice Site 965 1835 12 23
ENSDART00000142215 Essential Splice Site 966 1836 12 23
ENSDART00000142706 None None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28947609)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26823383
GRCz11 16 26696825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCTCAGAGTTCTGTGCCACATTGCCTGCCCACCAGCAACWGTGCCAGG[T/C]ACATTYACACATATTACAMACCTTARTCNNNNNTAAACAGGACAAAAAAAAGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28667
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Nonsense 1015 1835 13 23
ENSDART00000142215 Nonsense 1016 1836 13 23
ENSDART00000142706 None None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28949275)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26825049
GRCz11 16 26698491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTATTGCTGCCATGGCGACTGCATGGGCCAATGGGGCCCACAGCGCAA[C/T]GACTCATGATGCTGTCAGTGGCCTCCTGCTCGCTGAGACTCATCCGAGCC
Associated Phenotype:
Not determined