Busch Lab

ZMP

ZNF608

Ensembl ID:
ENSDARG00000075823
Description:
zinc finger protein 608 [Source:HGNC Symbol;Acc:29238]
Human Orthologue:
ZNF608
Human Description:
zinc finger protein 608 [Source:HGNC Symbol;Acc:29238]
Mouse Orthologue:
Zfp608
Mouse Description:
zinc finger protein 608 Gene [Source:MGI Symbol;Acc:MGI:2442338]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41094 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25379 Nonsense Mutation detected in F1 DNA Not yet available
sa34266 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41094
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112756 Essential Splice Site 355 1348 5 10
Genomic Location (Zv9):
Chromosome 8 (position 74645)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45804
GRCz11 8 224627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTGGGCACGCTTTTGGACTGTACCAAGCATGACTGGGCTCCACCAAG[G/A]TAATGTGCATAACACAAGTCAAAATTATGAGCCCTCCTGTGAAATCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25379
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112756 Nonsense 1108 1348 7 10
Genomic Location (Zv9):
Chromosome 8 (position 78563)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49722
GRCz11 8 228545
KASP Assay ID:
554-7377.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTCCTCTGGGTTTAGGCTTCAGAATCTCAGTCCTGGAGCCACTCTTAT[C/T]AGTCCAAATATGTGAAGCAGCAAAATCACGAGGTCAACAAGATCTCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34266
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112756 Nonsense 1169 1348 7 10
Genomic Location (Zv9):
Chromosome 8 (position 78747)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49906
GRCz11 8 228729
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTGCTGACGGTTCTGAAGAAAACACCCGGGCGGAGGGCGACGAAACAT[C/A]AGGCGAGACGTCTGAAGACTCCGCAAGAACCGCCGCAGCATCACCCCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8301
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112756 Essential Splice Site 1323 1348 9 10
Genomic Location (Zv9):
Chromosome 8 (position 82311)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53470
GRCz11 8 232293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGGCATGAGCTRCACGCTGGTGTCCGGACAATACGACCCCTTCCAAGG[T/C]GAAAAGGTCAAAATCAGCTGAAATACACTACACTACTCAMTMCAGCCTCT
Associated Phenotype:
Not determined