Busch Lab

ZMP

si:dkey-219c3.2

Ensembl ID:
ENSDARG00000075805
ZFIN ID:
ZDB-GENE-090313-238
Human Orthologue:
TAF4
Human Description:
TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf4a
Mouse Description:
TAF4A RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Ac

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17606 Nonsense Available for shipment Available now
sa17763 Nonsense Available for shipment Available now
sa38065 Nonsense Available for shipment Available now
sa24669 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17606
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109605 Nonsense 76 976 1 14
Genomic Location (Zv9):
Chromosome 25 (position 20763928)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20174717
GRCz11 25 20272371
KASP Assay ID:
2261-9664.1 (used for ordering genotyping assays)
KASP Sequence:
AGGTGGACAAAACAAGACAGTCGGTCCTCAAGGCGACGCCAGGAGAGCTT[C/A]GAACGCGCKAAATCCACACTTGGGGAAATTACTGCCCGCCCAAGTAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17763
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109605 Nonsense 747 976 9 14
Genomic Location (Zv9):
Chromosome 25 (position 20781855)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20192644
GRCz11 25 20290298
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGTGTRAACCTGAAYGAGGAAAACGCCCGTATCTTGGCCACGGGTTCA[G/T]AGCTGGTGGGCACCCARATCCGCTCCTGTAAGGATGAGGCCTTCCTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38065
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109605 Nonsense 863 976 12 14
Genomic Location (Zv9):
Chromosome 25 (position 20802149)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20212938
GRCz11 25 20310592
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAGCAGTCTATTTGAGTTGTAATGTTTCTGTTTGCCTGCAGAGTCGCT[C/A]GAGGCAAGAGGATCCCGAACAGGCCCGGCTGAAGCAGAAAGCTAAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24669
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109605 Nonsense 875 976 12 14
Genomic Location (Zv9):
Chromosome 25 (position 20802184)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20212973
GRCz11 25 20310627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTGCAGAGTCGCTCGAGGCAAGAGGATCCCGAACAGGCCCGGCTGAAG[C/T]AGAAAGCTAAAGAGGTGAGCTTTATGGAAGACTATTTAATAGTACTAATA
Associated Phenotype:
Not determined