Busch Lab

ZMP

si:ch211-15l13.1

Ensembl ID:
ENSDARG00000075792
ZFIN ID:
ZDB-GENE-041210-343
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5PNQ8]
Human Orthologue:
IQSEC3
Human Description:
IQ motif and Sec7 domain 3 [Source:HGNC Symbol;Acc:29193]
Mouse Orthologue:
Iqsec3
Mouse Description:
IQ motif and Sec7 domain 3 Gene [Source:MGI Symbol;Acc:MGI:2677208]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31400 Essential Splice Site Available for shipment Available now
sa30852 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6950 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31400
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113971 Essential Splice Site 1029 1143 10 14
ENSDART00000138846 None None 602 None 6
Genomic Location (Zv9):
Chromosome 4 (position 26007388)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26714008
GRCz11 4 26703206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGACCATGGGACTGCTGGGCATGCAGTTCCACCTGTTTGAGAACGAAT[G/A]TAAGTTCCAACAGTTTTTTTATAGAATTATTTTTGAGTTTTTCTATCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30852
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113971 Essential Splice Site 1083 1143 11 14
ENSDART00000138846 None None 602 None 6
Genomic Location (Zv9):
Chromosome 4 (position 26039822)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26746442
GRCz11 4 26735640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAGAATCAATTGCTGAAGTGTCAGAGATGGAACAGATAAGAATTGAAT[G/A]TGAGTGGACTTTCAATTTCAGTTCAGTTCAATTCACATTTATTTGCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6950
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113971 Nonsense 1139 1143 14 14
ENSDART00000138846 None None 602 None 6
Genomic Location (Zv9):
Chromosome 4 (position 26066067)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26772687
GRCz11 4 26761885
KASP Assay ID:
554-4762.1 (used for ordering genotyping assays)
KASP Sequence:
AAACTAGGTGTCAATTCACAACAGGCTTCAGACGTTCCAGCTCAATGCTG[C/A]ACCGCTGAGCCCTGAGAATGCTGCCCATCTCAACCACCAGAGGGAGCCCA
Associated Phenotype:
Not determined