Busch Lab

ZMP

si:ch73-190m4.1

Ensembl ID:
ENSDARG00000075785
ZFIN ID:
ZDB-GENE-090311-56
Description:
Novel protein similar to vertebrate hect domain and RLD 3 (HERC3) [Source:UniProtKB/TrEMBL;Acc:B8JLD
Human Orthologues:
HERC5, HERC6
Human Descriptions:
hect domain and RLD 5 [Source:HGNC Symbol;Acc:24368]
hect domain and RLD 6 [Source:HGNC Symbol;Acc:26072]
Mouse Orthologue:
Herc6
Mouse Description:
hect domain and RLD 6 Gene [Source:MGI Symbol;Acc:MGI:1914388]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa19588 Nonsense Available for shipment Available now
sa44513 Nonsense Mutation detected in F1 DNA Not yet available
sa482 Essential Splice Site Confirmed mutation in F2 line Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7914
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Nonsense 222 992 5 24
ENSDART00000131544 Nonsense 222 350 5 8
ENSDART00000140883 None None 408 None 10
Genomic Location (Zv9):
Chromosome 1 (position 51126536)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49975627
GRCz11 1 50619453
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTTACACAACAGACAGATTCGTCCCAACAGTTGTAAATAGTCTTAAA[C/T]GAAAGAAGATTGTGTCCRTCTCATGTGGAGGAGAACACACTGCAGCTCTA
Long Flanking Sequence:
GTTGACTGTTGAAATGTAAAGTTTTTGACCCAACTGGTTGAGTTATCAAATAAATAACCCAAAAAAAGCTAAAAATAACCCAACAAAGCACCAAACATTTAACCCAAGTGGTTGAGTTAATAATAAATAACCCAATAAAGGTTTAAAATAACCCAACAAAGCACCAAATATTTTACCCAACTAGTTGGGTTAATAATTAAAAACCCAATAAAGGTTCAAAATAACCCAACAAAGCACCAAATATTTTACCCAGCTGGTTGAGTTAATAATAAAAAACCCAATAAAGGTTCAAAATAACCCAACAAAGCACCAAATATTTTTAACTTAACAATTGTGTTAAATAAATGACCCAACGTTTTTTAGAGTGTGATGGCACTTTTAAAATAAGTTTAATGACACATAAAAACCAGTATCACAGAATAAAATATTTTAGAAGTGACCAATACACTGTTTTTTACACAACAGACAGATTCGTCCCAACAGTTGTAAATAGTCTTAAA[C/T]GAAAGAAGATTGTGTCCATCTCATGTGGAGGAGAACACACTGCAGCTCTAGCAAAGGTAGTATATTAAAATATGTTACATATTCATGTTTTAGATTTCACCAATATTTCCATCCGAATATACAACAAGCTGGACGGAAAAACGTTTGTAATTTTCAGGGAGGAACAGTGTTCACATTTGGATCAGGAGGTTTCGGTCAGCTTGGGCACAACTCATTTAAAGATGAACATCATCCACGACTGGTTGCTGAACTGTGGGGATCTAAAGTGTCACAGGTCACATGTGGGAGGTAAACTAGAGTCTTCAGTAGCTTTATTAGAAATAGGCCCACATGGAATCTGCGCGCCCAGATTTGCGTAGATTTTTAGTCCATCATTGATTCTGTTTATTTACTTGTGTGAATGTTTGTAAATTTATATTTATTCAGTTTTATTAATTTCAGTAATATTATTGACTGATTTAAAAATACTCAAATAATTCATTTACAATACAGTTTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19588
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Nonsense 332 992 8 24
ENSDART00000131544 Nonsense 332 350 8 8
ENSDART00000140883 None None 408 None 10
Genomic Location (Zv9):
Chromosome 1 (position 51128099)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49977190
GRCz11 1 50621016
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGTAAACTAACTAAATGCTTCTCACACACAGAATATAATGACGAATA[T/A]ACAATTCAAAAACTTGTCGCGGGGGAGAATCATTCGTTTGCCTTGTATTT
Long Flanking Sequence:
ATTCTATGCAGAAAAAGCAAAAAATTTCCACAGATTCTGTTTGGCCCTAGCAAAAGGCAATTCAGAACAGCTGAGTTGTAAAGCTGAACTCTCAGTTCAGAGTTCAGCTTTATTTACTCAATAATTTCCCAAGTGAATTATTAATGACATTAAATAGTGAAGGTAAATTGAAATTCATACGCAACTCTGAAAAATGGCTCCAGCTGTGTTCAGTAATTTGACTTTTCATTTTTTCTGCATTAAGAAATCACACACTTGTATCGACTGCATCACCAAAGCTGATCTACTCATTTGGATGTGGGATGCAAGGGCAGCTGGGAAATGGAGAACAGGTCAAGCAGTCTGTGCCGTTACCAGTAGACCAGCCAACTGGTGACTTGGTTTTGTAGTAGCATAGTATTTTGTATATACATATATATTATATATATATTTATACATTAAGTAGATCAGAACTGTAAACTAACTAAATGCTTCTCACACACAGAATATAATGACGAATA[T/A]ACAATTCAAAAACTTGTCGCGGGGGAGAATCATTCGTTTGCCTTGTATTTCAAAGTAAGATGGATAGTTTTCATTCATAAATAGTTTGAAAGATAAATCACTGCTACACTGTGATGATTAATTATATGTTATGTTTTGTAGGAACTTGGAAATGAGGCTAATCCAGATCCAACCAGAGGGATTATGACATTTGATAACGGAATGATTGAACAATGCGAGTGTGGAAAAGATCCACGGAAAGCGATAAAGTGAATAAATGGCATCTTTATACTCTTTTCACTTGTTAGAAAATATCACAAACAATAATAAATAAATGGAAAATGACAATAATACAAGTTACAATTATAATTGTAATGCACTCTTTTAATAATTTCTGTTTCATTTTAAAAAATGTATATACACTCACCGGCCACTTTATTAGGTACACCTTACTAGTAGCTGGTTGGACCCCCTTTTGCCTTCAGAACTGCCTTAATCTTTCGTGGCATAGATTAAACAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25667
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Essential Splice Site 406 992 10 24
ENSDART00000131544 None None 350 None 8
ENSDART00000140883 None None 408 None 10
Genomic Location (Zv9):
Chromosome 1 (position 51129997)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49979088
GRCz11 1 50622914
KASP Assay ID:
2259-1104.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGTGTTCTCCTCTGCTGCATCTCTAAATGGAAGTTTTCTCAAAACAAG[G/A]TAAACTTTCGTTTGTTTTGGTACTTTTCCCACCAATGTATTAAAAAGAGA
Long Flanking Sequence:
CGTCTGGCACCAACAACCATGCCACATTCAAAGTCACTTAAATCACGTTTCTTTCCCATCCTGATGCTTTAAGCCACTTCTATACACCTTTAAGTGACATTTAAAGGCTTAACTAGGTTAATTAGGTTAACTTGGCAGGTTAGGGTAATTAGGCAAGTTATTGTATAATGATGGTTTGTTCTGTATATTATCAGAAAAAATAGTGCTTATAGGGGCTAAAAATTTTGACCTTAAAATGGTTTTAAAAATTAAAAACTGCTTTTATTCTAGCTGAAATAAAACAGATAAAACTTTCTCAAGAATAAAAAATATTATCAGACATACTGTGAAAATTTCCTTGCTCTGTTAAACATCATTTGGGAAATGTTTGAAAAAGAAAAAAAATTTAAAGGGGGGCGAATAATAATTGTGACTTTAACAGTTTGTGTATATGTTCGCAGGGACTTGAAAAAAGTGTTCTCCTCTGCTGCATCTCTAAATGGAAGTTTTCTCAAAACAAG[G/A]TAAACTTTCGTTTGTTTTGGTACTTTTCCCACCAATGTATTAAAAAGAGACACTTAGATTTCAGTGTAGATGTCTTTCTTTGTAGGCATGATGGTCATTATCAGACGTCTGAAGAGTATTGTGGTTTGGATTTTGGTCTGGTTGAATCTTCCATTGCAACTTTATCAAGGAATGAAAGGCTTATCTCAACGGTATGGTGAATCCAATATTTGCTAACAGGTTGCACCTAAAAAATGGAGGTGCTTTCCTGTTTATTCTAGTGTGTAAATATGACTCTTTTAACTAAGTTTTTAAGGGAGAGACCTTTGATGGGTGTATGTACACTGAAAAAGATGAAACTACAATGTCTTTCATTCAAAGTAGTTTTTTTTATATTGAATTAAGTGAAAATACATGGTTTCTGATTTTAACCTTTTTTATTTAGTTTGCCTCTAAGCGCAAAATTAACCCCTATGAAAAATTAAAAGCATTGTTTTTTTCCTAAAAGTGATTTTACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44513
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Nonsense 714 992 18 24
ENSDART00000131544 None None 350 None 8
ENSDART00000140883 Nonsense 130 408 4 10
Genomic Location (Zv9):
Chromosome 1 (position 51135335)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49984426
GRCz11 1 50628252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAACGTGTTTAAGGAGCTTTGTGATCCAGCTTCTCAGCTCTTCATGTA[T/A]AACGACAACGAAACTATGATCTGGTTCCCCGCGAAGGTAAGGCAAAGACT
Long Flanking Sequence:
TCTCAGAGATAAATGGCTGTCGGTAAGCAACAAGAATGAGTTGCACACAGTACAGTGTTTGCATGTTTTGTTTTGATTTAATAACAAAGCAACAATTTAGTATGGAGGACAAATCCCTGCGGCTAGTTTCTTGATAGCTTGCTTCTTATCCAATTTTTAGTACTTCTAAAGCACATGTATTTATAATGCCTCATTCTGAATGCGTTTGTTAAAGCAATATAAATAAAATATAAATAAATAAAATGTAAATATAAACAAATAAATATAAATAAAATGTCAACCAACCTTAGTATAGGGAAGAATATTGCTTTGATAATCTGTCATGTTTGTGAAGGCTATTTATTAATTTCTTTTAATTTATAAGCTTTGGTATGAATTCATTTTTGGACACAGATTCTTTTCACTGAGAACGTGAGCAAAAGAACAGACGTCCACAAGAGGGACTTCTTTCTCAACGTGTTTAAGGAGCTTTGTGATCCAGCTTCTCAGCTCTTCATGTA[T/A]AACGACAACGAAACTATGATCTGGTTCCCCGCGAAGGTAAGGCAAAGACTTTTTTTATTATGTTAAAGGTTTATTTGTGATTGTTCCCATAACTCATTTTTACAGGATTATAGAATTATAGCACTATATGTACTTTTAATATTTAGATTAGTTCAGTGAAAATAAAATAAATAAAATATCTAATGATGCAAATTTAGATTTTTTTATTTAAATAACTTTTTGTTGTTGTTATTAATTTATAATCTACATTTTTATTATGATTTTATTATGATCACCAAAGATTTAGCAGTTGCAGATAGCTGGAGAACTACAAATCTTTAAATTTATCGAACTACAATTCCCATCATGCCTGGCACTCACACACCAGTTCTAGATCAGATTTTTGGAATTCACTTAGTGACCCCTACTCATTGTCCTGTGACCCCCACTTTGTGAACCACTGTTCTAGATTACCTCTTGATTTCACACTCACAGCTGCAGATCATCCTCATTGGTTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa482
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Essential Splice Site 726 992 18 24
ENSDART00000131544 None None 350 None 8
ENSDART00000140883 Essential Splice Site 142 408 4 10
Genomic Location (Zv9):
Chromosome 1 (position 51135372)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49984463
GRCz11 1 50628289
KASP Assay ID:
554-0333.1 (used for ordering genotyping assays)
KASP Sequence:
AGCTCTTCATGTATAACGACAACGAAACTATGATCTGGTTCCCCGCGAAG[G/T]TAAGGCAAAGACTTTTTTTATTATGTTAAAGGTTTATTTGTGATTGTTCC
Long Flanking Sequence:
GAGTTGCACACAGTACAGTGTTTGCATGTTTTGTTTTGATTTAATAACAAAGCAACAATTTAGTATGGAGGACAAATCCCTGCGGCTAGTTTCTTGATAGCTTGCTTCTTATCCAATTTTTAGTACTTCTAAAGCACATGTATTTATAATGCCTCATTCTGAATGCGTTTGTTAAAGCAATATAAATAAAATATAAATAAATAAAATGTAAATATAAACAAATAAATATAAATAAAATGTCAACCAACCTTAGTATAGGGAAGAATATTGCTTTGATAATCTGTCATGTTTGTGAAGGCTATTTATTAATTTCTTTTAATTTATAAGCTTTGGTATGAATTCATTTTTGGACACAGATTCTTTTCACTGAGAACGTGAGCAAAAGAACAGACGTCCACAAGAGGGACTTCTTTCTCAACGTGTTTAAGGAGCTTTGTGATCCAGCTTCTCAGCTCTTCATGTATAACGACAACGAAACTATGATCTGGTTCCCCGCGAAG[G/T]TAAGGCAAAGACTTTTTTTATTATGTTAAAGGTTTATTTGTGATTGTTCCCATAACTCATTTTTACAGGATTATAGAATTATAGCACTATATGTACTTTTAATATTTAGATTAGTTCAGTGAAAATAAAATAAATAAAATATCTAATGATGCAAATTTAGATTTTTTTATTTAAATAACTTTTTGTTGTTGTTATTAATTTATAATCTACATTTTTATTATGATTTTATTATGATCACCAAAGATTTAGCAGTTGCAGATAGCTGGAGAACTACAAATCTTTAAATTTATCGAACTACAATTCCCATCATGCCTGGCACTCACACACCAGTTCTAGATCAGATTTTTGGAATTCACTTAGTGACCCCTACTCATTGTCCTGTGACCCCCACTTTGTGAACCACTGTTCTAGATTACCTCTTGATTTCACACTCACAGCTGCAGATCATCCTCATTGGTTACTTGGACTATTTAAGCACCACAGCGACATTCATTTCTTGC
Associated Phenotype:
Not determined