Busch Lab

ZMP

zgc:171915

Ensembl ID:
ENSDARG00000075769
ZFIN ID:
ZDB-GENE-071004-44
Description:
Zgc:171915 protein [Source:UniProtKB/TrEMBL;Acc:A7MC05]
Human Orthologue:
LRCH3
Human Description:
leucine-rich repeats and calponin homology (CH) domain containing 3 [Source:HGNC Symbol;Acc:28637]
Mouse Orthologue:
Lrch3
Mouse Description:
leucine-rich repeats and calponin homology (CH) domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23203 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23203
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112658 Essential Splice Site 135 295 2 6
Genomic Location (Zv9):
Chromosome 18 (position 2420717)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3507585
GRCz11 18 3604670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCAGAAAGTCTGATCAACCTGCAGTCGCTCACCTACCTGAACCTCAGG[T/G]CATACAAACATAACATTCAGAACAGAACACTACACAACATAAGCTGCGTC
Long Flanking Sequence:
TTGAAATGGTATGATTTAGTTAATGTCAAATACATTAGCTCACCAATATTCAAAGATAGTAAATGACGACAGAATTTGTTTATTTAATGTAATATTTTATTTTCGCAAAAATGATTATCCCTTCGAGCTTCTAGTTCTTACCCTTTAAAGTCTATAACCAGTATTTTGTCTAATTCTGATCTAGAGGGTTTTCTGATACTGTGCACATCAAACACACTTTTACATGAGTGAAACTAAACACAGGTGTGCAGCACGTCTCTCCTGCCAGACATGCGTTTCTCATTGTCTTTTTCTCCATCTCTCTTTCTCTCTGTCACTTTCTCTCTCTTTTATCTGTTTTCCATCTCTTCTCAGATCTGTCTCGAAACAGGTTGACGGAGCTGCCAGTGGAGGTTTGCATGTTCGTGTCGCTGGAGAATCTGAACCTGTACCAGAACTGTCTGCGTTCACTACCAGAAAGTCTGATCAACCTGCAGTCGCTCACCTACCTGAACCTCAGG[T/G]CATACAAACATAACATTCAGAACAGAACACTACACAACATAAGCTGCGTCCCAAATGGCACACTATACACTATGCACTCATGCACTATGTACTTATGCACTTACACACTCAACAGGATAGTACATGTATGTAGTGGCGTCCCAAATGGCACACTAATGTTTTTTTACTAAGCGGAAATTCAAACCGTTTCCCTGATGACGTTTGACGGTCGCCAAATCAGTGAAATAAACGACCGAATTATCAAATATTACCTGCCGTGAGTGTTGCCGCATTCACCATCGGGAGGCGCTATAATCACTCTCGTAGAAGAATTTTGTTCTCACCATCCAAAATAAATAAAGTTATTCAACATGTGCGTCCGATAGCTCCGCCTCTTCCGCTACGTAAGCAAACCTGCGGTCGTTGAGTGCGTGAAGTGTCCATCATTACACACTTCATTTTAGCGGCTGAATGAGTGCATCATCCGGGAAATTAAAGTGCACTTATTATTTTTAGAGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28953
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112658 Nonsense 176 295 3 6
Genomic Location (Zv9):
Chromosome 18 (position 2417221)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3511081
GRCz11 18 3608166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAGCTGGTGTCTCTGCCGGAGGATCTGGGCAAACTCAGACAGCTCACT[G/T]AACTGGTGTGTGGAGCATTTCTGCTGTCCATCTGCACTAGGGCTCCAACA
Long Flanking Sequence:
TCACCTTTTACTTGTCTCCAGCCTGTTTTACATTCTTTTTTCTGCTGAACACTAAAGAAGATATTGCGAAGAATGCTGTAAACCACTAACCATTGACTTCCATAGTAGTTGTTTTTCCAGTCAATGGTTAAGTTTTCAGCTTTTTTTAAAATATCATATTTTGTGTTCAACAGAAGAAAGAAACTAAAAGGTTTACAACCAGTTAAGGTTGAATAAATGGGGATTAAGTTTTCATTTTAGGGGTTGAACTGCCTATTTAAATACTTTACAAGAAATCAGTCAGATTTATTTAGCAGCTGCAATTGTTTTTCCACATGAAAACTAATAATTTTCATATTTCCTCTACTCACATTTGTCATTTTCCTTATTTTCTCTGCAGTCGTAACCAGCTGTCAACTCTTCCTGCTCACCTGTGCCGGCTCCCTCTTAAAGTGCTGATCGCCTGCAATAACAAGCTGGTGTCTCTGCCGGAGGATCTGGGCAAACTCAGACAGCTCACT[G/T]AACTGGTGTGTGGAGCATTTCTGCTGTCCATCTGCACTAGGGCTCCAACATATTGGAAAAATCTGATATTGCGAGATTCTTTTTCTGTGATAAACATTGCGATATGAGTACAGTTTCACAAGATGGTCTGAATAGCTCTATTTGATGGTTTTCTGGATAGTCGTAACAGTATTCAGTTGCAGAAATTAAATCATAATCATATCATAATGCAAAAAGGCTTTTCTTACTTTGCTTTCTCGTTTTTAGTCTAAATACAGTGATCCCTCATTAATCGCTGGCAGTGTTGGGAAAGCTATTCGAAAAATGTGGTGAGCTAAGCTATTAGCTACTCCACTTAAAATGTAGCTTAACTTAAAACATAAATGCTTAGCATAAAAGCTACCCCCTGGGAAATGTAGCAGGCTAAGCTAAAAGCTACATGGCAAGATTAGCTTAGCTACATCTTAGCTATTTTTACAATTTTCATTTTTAAATTGAATCAACTTAAATCGAAGTCAATC
Associated Phenotype:
Not determined