Busch Lab

ZMP

cfh

Ensembl ID:
ENSDARG00000075761
ZFIN ID:
ZDB-GENE-050208-661
Description:
Novel protein containing multiple sushi domains (SCR repeat) [Source:UniProtKB/TrEMBL;Acc:A8E7E2]
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa29783 Nonsense Mutation detected in F1 DNA Not yet available
sa7495 Missense Mutation detected in F1 DNA Not yet available
sa29784 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa29783
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079311 None None 308 None 8
ENSDART00000105633 Nonsense 66 1005 2 20
ENSDART00000133313 Nonsense 105 837 3 16
Genomic Location (Zv9):
Chromosome 22 (position 24231524)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23641220
GRCz11 22 23667784
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCAGCAAACGCTGATTTTAAACTTTTAGATGGGACGGAGTTTGTATTT[G/T]GAACAACGGTGGTGTATACTTGCAAGAAAGGGTAAACTTGTTTCATGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7495
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079311 None None 308 None 8
ENSDART00000105633 Missense 101 1005 3 20
ENSDART00000133313 Missense 140 837 4 16
Genomic Location (Zv9):
Chromosome 22 (position 24231729)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23641015
GRCz11 22 23667579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAGCGTMCCTGCCGATCTCAAGGATGGGATAATGCCATCCCTGAGTGT[G/A]AAGGTATGCTTTTTTTTNCACTWTTTYCTTTTGTTTTCTSATAAACGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29784
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079311 None None 308 None 8
ENSDART00000105633 Essential Splice Site 162 1005 4 20
ENSDART00000133313 Essential Splice Site 201 837 5 16
Genomic Location (Zv9):
Chromosome 22 (position 24232023)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23640721
GRCz11 22 23667285
KASP Assay ID:
2261-6843.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTGCACAGAGAAGGGCGACTGGAGTGCCCCGGTTCCAAACTGCATAG[G/A]TTCGTTCAATTGTGCTTTATTTGATTTGTTTTTTTTTTTCTGAAATCACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29785
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079311 None None 308 None 8
ENSDART00000105633 None None 1005 None 20
ENSDART00000133313 Nonsense 492 837 10 16
Genomic Location (Zv9):
Chromosome 22 (position 24233612)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23639132
GRCz11 22 23665696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGAAATAACTTGTAATCCCCAGGCTCAATGGACAGGTTTACAGCAGTG[C/A]ACTGGTTTGTAAGATTACTGCCATTAATTCCACTCATTTTTTTATTTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29786
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079311 None None 308 None 8
ENSDART00000105633 Nonsense 941 1005 19 20
ENSDART00000133313 None None 837 None 16

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 24282494)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23590250
GRCz11 22 23616814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGGCTTCAAGACTTGTAAGAATGGTGAATGGACAGGAAATATTTATTG[T/A]TTAAGTAAGTATGATCAGACTACACCTAAGCATGTGTGCCACAACTTTCA
Associated Phenotype:
Not determined