Busch Lab

ZMP

LOC100149858

Ensembl ID:
ENSDARG00000075759
Human Orthologue:
SAMD4A
Human Description:
sterile alpha motif domain containing 4A [Source:HGNC Symbol;Acc:23023]
Mouse Orthologue:
Samd4
Mouse Description:
sterile alpha motif domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1921730]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31011 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3996
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108999 Nonsense 399 685 6 12
Genomic Location (Zv9):
Chromosome 17 (position 14932036)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15082864
GRCz11 17 15090797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCCATTTATTTGTCATCTCTCCCTCTCGCTCTTGCTTTCAGGATGTTT[T/A]GGAGGGAGGGAATCTACGTGCTCCATTGCAAGAGCTCCACCAGATCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31011
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108999 Nonsense 582 685 9 12
Genomic Location (Zv9):
Chromosome 17 (position 14939965)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15090793
GRCz11 17 15098726
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGGCAGTATCAGATGCGGAGTCTGCCCGGTATACGACCTGTCCCTTTG[G/T]GAAGCACCGGCCTGTTCGGACCAACCCCACGGAGCAGCAGCAGCACCCCG
Associated Phenotype:
Not determined