Busch Lab

ZMP

zgc:172352

Ensembl ID:
ENSDARG00000075748
ZFIN ID:
ZDB-GENE-080204-117
Description:
nck-associated protein 1-like [Source:RefSeq peptide;Acc:NP_001107884]
Human Orthologue:
NCKAP1L
Human Description:
NCK-associated protein 1-like [Source:HGNC Symbol;Acc:4862]
Mouse Orthologue:
Nckap1l
Mouse Description:
NCK associated protein 1 like Gene [Source:MGI Symbol;Acc:MGI:1926063]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45418 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45418
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086166 Nonsense 710 1123 19 30
Genomic Location (Zv9):
Chromosome 11 (position 202840)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 191381
GRCz10 KN150018.1 310
GRCz11 11 153816
GRCz11 KN150018.1 310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGACACGTCATCGTGCCGGCCGAGTTCCTGCTCACACAGCTGGAGATC[A/T]GACTCAACAAGTACACACACCTCACAACTACATTTCCCAGCATGCCTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18998
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086166 Nonsense 978 1123 26 30
ENSDART00000086166 Nonsense 978 1123 26 30
Genomic Location (Zv9):
Chromosome 11 (position 205556)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 194097
GRCz11 11 156532
KASP Assay ID:
2260-3749.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTGCCCTGTGAGATCGACCCCGCGCTGGTTTCCGCATTAGCAAACATG[C/T]AGACAGGTGAAGTCCTGATCGAGGAGACTCTGTGTGTGTTTAGAGCCGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3810
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086166 Nonsense 978 1123 26 30
ENSDART00000086166 Nonsense 978 1123 26 30
Genomic Location (Zv9):
Chromosome 11 (position 205556)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 194097
GRCz11 11 156532
KASP Assay ID:
2260-3749.1 (used for ordering genotyping assays)
KASP Sequence:
GTTTGCCCTGTGAGATCGACCCCGCGCTGGTTTCCGCATTAGCAAACATG[C/T]AGACAGGTGAAGTCCTGATCGAGGAGACTCTGTGTGTGTTTAGAGCCGTG
Associated Phenotype:
Not determined