Busch Lab

ZMP

rnf213

Ensembl ID:
ENSDARG00000075710
ZFIN ID:
ZDB-GENE-050302-100
Human Orthologue:
RNF213
Human Description:
ring finger protein 213 [Source:HGNC Symbol;Acc:14539]
Mouse Orthologue:
Rnf213
Mouse Description:
ring finger protein 213 Gene [Source:MGI Symbol;Acc:MGI:1289196]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17502 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26163
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108501 Nonsense 275 1757 7 37
Genomic Location (Zv9):
Chromosome 3 (position 57308780)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56691498
GRCz11 3 56758934
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCGGAACAAGGGTTGTACCATGCCTTTCAGCTGGAGGATTAAAGATTA[T/A]CTAGAGGATCTCTGGAAACATGCTCTGCAGCAAGAAGGTACTTTTACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17502
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108501 Nonsense 860 1757 18 37
Genomic Location (Zv9):
Chromosome 3 (position 57332856)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56716001
GRCz11 3 56783437
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGGGGTTGAATGTGTCAAGAACCTTCTCCTRCAGGAAACRTAYAGATG[G/A]CTGTTTCCCCAGGAGATTCTTGAGATGGTGGGTTTGAGTTCATTTAACTT
Associated Phenotype:
Not determined