Busch Lab

ZMP

si:ch211-106h4.9

Ensembl ID:
ENSDARG00000075706
ZFIN ID:
ZDB-GENE-070705-17
Description:
Novel protein similar to vertebrate myosin VIIA and Rab interacting protein (MYRIP) [Source:UniProtK
Human Orthologue:
MLPH
Human Description:
melanophilin [Source:HGNC Symbol;Acc:29643]
Mouse Orthologue:
Mlph
Mouse Description:
melanophilin Gene [Source:MGI Symbol;Acc:MGI:2176380]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa39853 Nonsense Mutation detected in F1 DNA Not yet available
sa6849 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39852 Nonsense Mutation detected in F1 DNA Not yet available
sa44535 Nonsense Mutation detected in F1 DNA Not yet available
sa14035 Nonsense Available for shipment Available now
sa32949 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39853
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111810 Nonsense 86 1173 2 16
ENSDART00000132955 Nonsense 62 159 2 4
ENSDART00000135668 None None 193 None 4
ENSDART00000144383 Nonsense 86 313 2 8

The following transcripts of ENSDARG00000075706 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31366680)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31667740
GRCz11 2 31650958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATTCACCTTCCTGCTCAATACCAAGCGTTCCTGCCTGGACTGCAGCTA[T/G]AACATCTGCAAAAGCTGCTGCACCTACAGTAAGAAGGACAAAGCCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6849
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111810 Essential Splice Site 217 1173 6 16
ENSDART00000132955 None None 159 None 4
ENSDART00000135668 None None 193 None 4
ENSDART00000144383 Essential Splice Site 217 313 6 8

The following transcripts of ENSDARG00000075706 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31356855)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31657915
GRCz11 2 31641133
KASP Assay ID:
554-5165.1 (used for ordering genotyping assays)
KASP Sequence:
ATTATTCATTCATACTGTCTGCTCAGAAACTTNNNNATATTTTCTTTTGA[A/G]GGAGAAGCAGAATGAAGCTCAATATCTGCGGCAGAACAGAGGAGAGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39852
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111810 Nonsense 598 1173 10 16
ENSDART00000132955 None None 159 None 4
ENSDART00000135668 None None 193 None 4
ENSDART00000144383 None None 313 None 8

The following transcripts of ENSDARG00000075706 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31351679)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31652739
GRCz11 2 31635957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGTTGACTTCCAAACTGAAAGAACTAACCAGTCAAGTCCGAGAAACA[C/T]AACTCTCCTCTACTGAGGATGAACTGGACAGGATGGAGTTTCGAATGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44535
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111810 Nonsense 681 1173 10 16
ENSDART00000132955 None None 159 None 4
ENSDART00000135668 None None 193 None 4
ENSDART00000144383 None None 312 None 8

The following transcripts of ENSDARG00000075706 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31351430)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31652490
GRCz11 2 31635708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGAGAGAACTGACCAGTGAGGTCACCGAGACTCAACTTTCCTCCACT[G/T]AAGATGAACTAGATAGATTTGAGTGTCAAACTAAAACCAAATGCCTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14035
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111810 Nonsense 810 1173 10 16
ENSDART00000132955 None None 159 None 4
ENSDART00000135668 None None 193 None 4
ENSDART00000144383 None None 313 None 8

The following transcripts of ENSDARG00000075706 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31351043)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31652103
GRCz11 2 31635321
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCRAGACTAAAGGAAGAGAAGCAGWAATAAGTGATGTGGTTGAAGGTCAG[C/T]AGAGCCGAGCCGAGAATACAGATCTGGCTCTCARTAGATTTGKAAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32949
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111810 Essential Splice Site 1117 1173 None 16
ENSDART00000132955 None None 159 None 4
ENSDART00000135668 Essential Splice Site 174 193 None 4
ENSDART00000144383 None None 313 None 8

The following transcripts of ENSDARG00000075706 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31343698)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31644758
GRCz11 2 31627976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGCCATTTCAATATCTGCTTGCCTTCATCTGTGTTATTTCTGTTTTCC[A/C]GGTTTTAGACATTTCCTCAAGAATTGCCGCTTTGAAAAATGCAGGTTTGA
Associated Phenotype:
Not determined