Busch Lab

ZMP

si:ch211-160m22.1

Ensembl ID:
ENSDARG00000075687
ZFIN ID:
ZDB-GENE-081107-12
Description:
Novel protein similar to H.sapiens ANAPC1, anaphase promoting complex subunit 1 (ANAPC1) [Source:Uni
Human Orthologue:
ANAPC1
Human Description:
anaphase promoting complex subunit 1 [Source:HGNC Symbol;Acc:19988]
Mouse Orthologue:
Anapc1
Mouse Description:
anaphase promoting complex subunit 1 Gene [Source:MGI Symbol;Acc:MGI:103097]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa38973 Nonsense Mutation detected in F1 DNA Not yet available
sa2701 Nonsense F2 line generated Not yet available
sa5608 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28201
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Essential Splice Site 72 1932 2 47
ENSDART00000133146 Essential Splice Site 72 500 3 13
ENSDART00000140045 None None 1336 None 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47476626)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46728631
GRCz11 13 47018466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGATAAGTAAATACTGCATGTTTTGAGCTTGATTATGGTGTGATTGGCA[G/A]GAGCGCTGGCAGCTGAGGAAGGGAACGGCTCCTGATGATGTTGAATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38973
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Nonsense 245 1932 7 47
ENSDART00000133146 Nonsense 245 500 8 13
ENSDART00000140045 None None 1336 None 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47488724)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46740729
GRCz11 13 47030564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCGGCTCCAGTATGTTTCAGACAGCGCTCTGAGAGTGGTGTTCACCTG[C/A]CTCAAACCCTCCATTATCATGACCTACGACACACAGCAGTGCACACACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2726
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Nonsense 711 1932 18 47
ENSDART00000133146 None None 500 None 13
ENSDART00000140045 Nonsense 115 1336 4 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47523016)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46775021
GRCz11 13 47064856
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTTTTTTCTGTTCTGACAGGATTGGCTGTATCTCCGYTGCTCAGACTA[T/A]CATTGGCAGGTGTCCATGCGGCCTGCGGTGTCTGTTCAGGGTCTGGAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3832
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Nonsense 929 1932 23 47
ENSDART00000133146 None None 500 None 13
ENSDART00000140045 Nonsense 333 1336 9 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47552446)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46804451
GRCz11 13 47094286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGAAGCCCATATCTTCATCCGGATGCCTGGCTGAGAAGCTGGTGCTGTG[G/A]TTAACCTCCGCAGGTCAGAAACTAAACTCTTTGGCCTGTTGATYCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2701
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Nonsense 977 1932 24 47
ENSDART00000133146 None None 500 None 13
ENSDART00000140045 Nonsense 381 1336 10 33
ENSDART00000109247 Nonsense 977 1932 24 47
ENSDART00000133146 None None 500 None 13
ENSDART00000140045 Nonsense 381 1336 10 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47555698)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46807703
GRCz11 13 47097538
KASP Assay ID:
554-3051.1 (used for ordering genotyping assays)
KASP Sequence:
AACACCCCTGCTCTGATTGGTCCGAAGAGGTCTGCGCTCTGATTGGCCGA[C/T]AGGACCTGACCAGACAAGCKCACAAAGTCACTCTAGCCAATCGTAAATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5608
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Nonsense 977 1932 24 47
ENSDART00000133146 None None 500 None 13
ENSDART00000140045 Nonsense 381 1336 10 33
ENSDART00000109247 Nonsense 977 1932 24 47
ENSDART00000133146 None None 500 None 13
ENSDART00000140045 Nonsense 381 1336 10 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47555698)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46807703
GRCz11 13 47097538
KASP Assay ID:
554-3051.1 (used for ordering genotyping assays)
KASP Sequence:
AACACCCCTGCTCTGATTGGTCCGAAGAGGTCTGCGCTCTGATTGGCCGA[C/T]AGGACCTGACCAGACAAGCKCACAAAGTCACTCTAGCCAATCGTAAATCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3878
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Essential Splice Site 1353 1932 30 47
ENSDART00000133146 None None 500 None 13
ENSDART00000140045 Essential Splice Site 757 1336 16 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47575688)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46827693
GRCz11 13 47117528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTGGCATYAACAGAGAGAAACACAAATCTCCCAGCTATCAGATCAAGG[T/C]GGAGTCCRCTAATACTGACGCTCATCTAAAGCTCTTTCTAGTCGATTAAA
Associated Phenotype:
Not determined