Busch Lab

ZMP

si:ch1073-154c4.1

Ensembl ID:
ENSDARG00000075676
ZFIN ID:
ZDB-GENE-100922-114
Human Orthologue:
FNDC7
Human Description:
fibronectin type III domain containing 7 [Source:HGNC Symbol;Acc:26668]
Mouse Orthologue:
Fndc7
Mouse Description:
fibronectin type III domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2443535]

Alleles

There are 26 alleles of this gene:

Allele Name Consequence Status Availability
sa10770 Nonsense Available for shipment Available now
sa29857 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6719 Nonsense Mutation detected in F1 DNA Not yet available
sa37591 Nonsense Mutation detected in F1 DNA Not yet available
sa37590 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10526 Essential Splice Site Available for shipment Available now
sa39391 Nonsense Mutation detected in F1 DNA Not yet available
sa9051 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31077 Nonsense Mutation detected in F1 DNA Not yet available
sa3218 Nonsense F2 line generated Not yet available
sa24238 Essential Splice Site Available for shipment Available now
sa19309 Nonsense Mutation detected in F1 DNA Not yet available
sa37589 Nonsense Mutation detected in F1 DNA Not yet available
sa12031 Essential Splice Site Available for shipment Available now
sa24237 Essential Splice Site Available for shipment Available now
sa37588 Nonsense Available for shipment Available now
sa15780 Nonsense Available for shipment Available now
sa8958 Nonsense Mutation detected in F1 DNA Not yet available
sa39390 Nonsense Mutation detected in F1 DNA Not yet available
sa43903 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10770
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 160 4636 3 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1653002)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1621277
GRCz11 23 1630386
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCWACCTGTGGACAAGGYTCTAGTCTACAACCTTACCATCAAAAACTG[G/A]AATTCGATAAACACTACACTATATTCRAGCACTGTGTTCAACAACACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29857
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 390 4636 5 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1648425)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1616700
GRCz11 23 1625807
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAACAGCAGTGCAACTCCCCATCCAGTTCAGCGATTCAAATACGAACTG[G/A]TAACAATAAATATATCTTCAAAATCTATACGTGTTTATCATGACTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6719
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 409 4636 6 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1647897)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1616172
GRCz11 23 1625279
KASP Assay ID:
554-4739.1 (used for ordering genotyping assays)
KASP Sequence:
CTGYCCACCAAGGAACATGCGCACGTCCACCGACTGTCAGACAGATGTGT[T/A]GACCAGCAGCTGGGAAGGTGCGGATGGAGCCMTACGGTACACAGTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37591
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 990 4636 12 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1642777)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1611052
GRCz11 23 1620159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGTGGTAAGAACTACACTGCCATCATCACAGCATCCAATGGAGAGTG[T/A]CAAGGGCCAGGGAGCCAGAGCCGTCCTGTCCAAACAGGTGAGATTTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37590
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 1090 4636 13 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1640316)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1608691
GRCz11 23 1617798
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATAATCAGTGCCACAGCTTAGCCGGCTCCAACGTCTCTGTGACAACAGG[T/C]AGGGAAACGCATCAGTTTCACCTTGATAGAAAGGCCAAGGGATTTTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10526
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 1265 4636 15 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1636441)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1604816
GRCz11 23 1613923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGMCCGCAGTGCTGGAGTWCACCCAGTGCTCCRTTCAGTGTTATCACAG[G/A]TACGTSCACCACACATTCAAAGTTCAGCATCTAGTGATGTGCATTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39391
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 1347 4636 16 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1635731)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1604106
GRCz11 23 1613213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGCAGTCCATTTCTAGTCACTGCAACAGCAGCTATGCAGCACGCACG[C/T]AGCTACAGACAGGTGAACACGCATACACACACTGTACAAGCATCCTATGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5018
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 1523 4636 18 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1634567)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1602942
GRCz11 23 1612049
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTACGGTGGACCGTGGTTGCAAGAGTCAACCCAGCACACCAGTCAGTCTA[C/T]AATCAGGTCAGCAAACAGGACAAGTAGTAGTATAGGATTTCTCTTATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9051
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 1524 4636 18 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1634560)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1602935
GRCz11 23 1612042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACCGTGGTTGCAAGAGTCAACCCAGCACACCAGTCAGTCTAYAATCAG[G/A]TCAGCAAACAGGACAAGTAGTAGTWTAGGATTTCTCTTATCATATTGYRT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29856
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 1686 4636 20 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1632385)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1600760
GRCz11 23 1609867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGTGGAAATACCTATACAGCTACAGTGGTTTCCACTGTTGGCTTCTG[C/A]AACAGCACTTTTAACAACAGCATTCATTTTGAATCAGGTAATTGAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31077
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 2285 4636 27 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1625136)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1593511
GRCz11 23 1602618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACCACAGAGACCAGCTGCAATATCAGTCTGAGATGTGGCATGAATTA[T/A]AATCTGACAGTAGTACCATTAAGAGATGGCTGCATTGGGGCAAATTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3218
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 2452 4636 29 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1624446)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1592821
GRCz11 23 1601928
KASP Assay ID:
554-2709.1 (used for ordering genotyping assays)
KASP Sequence:
CGGACAGACCATCTGCTGCACTGCAAACTCCACTTCCTGTGAGGTCACTT[C/A]AATTCCTTGCGGACAGATGTATGTCCTGACAGTCACTGCTGAGGGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24238
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 2571 4636 31 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1621471)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1589846
GRCz11 23 1598953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTTTCCTAATCGCTTGATCTTGATTTGATTCACTTTCTTTATGTCTA[G/A]TACCTTGTGTGCCGGATTTTGTGACTGCTAATGTGATATGCCAATCGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19309
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 2633 4636 31 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1621285)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1589660
GRCz11 23 1598767
KASP Assay ID:
554-6175.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGAGCATGAACAACACCTCCTGTACAATTAATGGACTTCCCTGCGGT[C/T]AGACCTACCATATCAGTGTGATAGCATCTGACGGATACTGCGATAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37589
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 2982 4636 35 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1617047)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1585422
GRCz11 23 1594529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCATTTCTCAAGAAAATTACTGTAACGTTAGTAATCTAGCCTGCGGA[C/T]AGACATATAAAGTGAGGCTGACAGCAATCAATCATGGATGTCAGGTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12031
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 3182 4636 38 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1614571)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1582946
GRCz11 23 1592053
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTGTTACTGGRTTGTGTATCTATTGTGTGTKTGTTTKTTTTYTCTATA[G/A]CCCCATGTGTGCCGTACAACACCAATACCTTTGTGGAATGCCARAATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24237
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 3356 4636 39 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1613906)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1582281
GRCz11 23 1591388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACATATATGCTGGAGCACAGCCAGCAATGTTTCAGTGCTGCAGACAGG[T/C]TAGGATCCTCTCACACACATGCACAGACACGGTGTCAAAACATGTAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37588
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3474 4636 41 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1612653)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1581028
GRCz11 23 1590135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGCGGAAGCTCATGTGTCCTGGAATGCAAGCATGGGGGCGATGTACTA[C/A]ACTGTGTACGCCTGGAGCACAACATTCAATTTCATATCCTGTGATAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15780
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3624 4636 43 55
ENSDART00000136037 Nonsense 40 213 2 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1609534)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1577909
GRCz11 23 1587016
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTCGCTCTCTCTTTTCYTCTCTCSCTGTGAACAGTACCCTGTCCACCC[C/T]AGAATGTGCTTTCAAATATGCTCTGCTCTTTAAGTTCTGCCAATGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8958
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3693 4636 43 55
ENSDART00000136037 Nonsense 109 213 2 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1609325)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1577700
GRCz11 23 1586807
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAWTGTGGCTCCGTTTACAACATCAGTGTGCTTGCCCTTGGTCATCACTG[T/A]AATGTGTCCAAGAGTGCARTCACAACACTGCATTCAGGTRGGCAACTGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29855
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3881 4636 46 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1608448)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1576823
GRCz11 23 1585930
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTATTGACAAGGCTAATTCATGATTGGCTCCTATCCCTCAGTTCCATG[T/A]CCACCTACCAGTGTGCAAGCATCTCTTGTGTGCCTGTCTAACTCCGCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39390
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3943 4636 46 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1608262)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1576637
GRCz11 23 1585744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAATGTGACGCACTGTAACCTGGAGCACCTGAGCTGTGGACAGACATA[C/A]AATATCTCTGTGCTTTCCATGGATCAAGCGTGCAGCAGTGAATATAGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29854
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3963 4636 46 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1608204)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1576579
GRCz11 23 1585686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGCTTTCCATGGATCAAGCGTGCAGCAGTGAATATAGTTTGTTCACA[C/T]AACTGACTACTGGTAAGTGGTAAACATTCATTTTGTTTTGCATTTGCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29853
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 4006 4636 47 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1605780)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1574155
GRCz11 23 1583262
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCAGCCAATCCAGATGCACAATCTTTTCGCGTGAAGGCAGTAAGCAGT[G/T]AAGGAACGTTCCTGTCCTGTAATTCCACCAGCACCACCTGCTCAATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43903
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 4140 4636 48 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 Essential Splice Site 112 310 2 5
Genomic Location (Zv9):
Chromosome 23 (position 1605234)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1573609
GRCz11 23 1582716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATTCATTCTGTCAGAGCAGCCCTGGCACAAGCTTTCAGATTCAGACAG[G/A]TGCGAACACACTTAAATGAACCACCCATCAGTTAAACTCAGAGCTTTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29852
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 4401 4636 51 55
ENSDART00000136037 None None 213 None 4
ENSDART00000143841 None None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1602620)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1570995
GRCz11 23 1580102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGGAACCTGTAACAGCTCCCAGACTGCTCCGATCCAGAAGGGAGCAG[G/A]TATACAACTACAAATGCTTGATAACTTTACACAGGGCCAGTCCTAGACTT
Associated Phenotype:
Not determined