Busch Lab

ZMP

tlr4al

Ensembl ID:
ENSDARG00000075671
ZFIN ID:
ZDB-GENE-090507-2
Description:
Novel protein similar to toll-like receptor 4 family [Source:UniProtKB/TrEMBL;Acc:B8A690]
Human Orthologue:
TLR4
Human Description:
toll-like receptor 4 [Source:HGNC Symbol;Acc:11850]
Mouse Orthologue:
Tlr4
Mouse Description:
toll-like receptor 4 Gene [Source:MGI Symbol;Acc:MGI:96824]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11530 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11530
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113952 Nonsense 95 793 2 2
Genomic Location (Zv9):
Chromosome 13 (position 18570254)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18390289
GRCz11 13 18521281
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGGAAACCCYATTAYATATTWTGCTCCTGGATGCTTGAATACTTTAWA[T/A]AATCTGCAAAGGCTWGTTCTYGTGGATRYTGGTCTTGAATCCTTACAGCY
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19058
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113952 Nonsense 437 793 2 2
Genomic Location (Zv9):
Chromosome 13 (position 18571280)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18391315
GRCz11 13 18522307
KASP Assay ID:
2260-6255.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGATATTTCTTATTCAAGCGTAACCTTTGTTAACGTATATTGCTTTTA[T/A]GGACTGAGCAGTCTTAAAGTTCTCAAGATGGCTGGCAATAGTTTTCAAGG
Associated Phenotype:
Not determined