Busch Lab

ZMP

A9ULT1_DANRE

Ensembl ID:
ENSDARG00000075664
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9ULT1]
Human Orthologue:
DHCR7
Human Description:
7-dehydrocholesterol reductase [Source:HGNC Symbol;Acc:2860]
Mouse Orthologue:
Dhcr7
Mouse Description:
7-dehydrocholesterol reductase Gene [Source:MGI Symbol;Acc:MGI:1298378]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32069 Nonsense Available for shipment Available now
sa36007 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2797 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa32069
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109825 Nonsense 80 437 3 11
Genomic Location (Zv9):
Chromosome 15 (position 46765628)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47284776
GRCz11 15 47872404
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTCCTGGGTTCTGCTCAGCTCTGGATCCTCCATCTGGGACTGGTGGT[C/A]AGTGTGTGTGCTGCTGTCCTTTACTGTCCTGCAGGTGGCGCTCTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36007
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109825 Essential Splice Site 220 437 6 11
Genomic Location (Zv9):
Chromosome 15 (position 46766333)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47284071
GRCz11 15 47871699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCGATGTCAAACACTTCGTGATGGTCAGGATTGGGTTCATTGGCTGG[G/A]TGAGTGTGTGTGTGAACGCTTCTTCTTCTCAATCAAGTGTGCAAATGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa434
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109825 Nonsense 329 437 9 11
Genomic Location (Zv9):
Chromosome 15 (position 46767863)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47282541
GRCz11 15 47870169
KASP Assay ID:
554-0286.1 (used for ordering genotyping assays)
KASP Sequence:
ATTATTTACTGACAGGTGTTGGCTTCCTGATTTACTACCTGTCCAACGAG[C/T]AGAAAGATGGTTTCCGCAAAAATCCAGATGATCCGGCATACGCTGGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2797
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109825 Nonsense 380 437 10 11
Genomic Location (Zv9):
Chromosome 15 (position 46768594)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47281810
GRCz11 15 47869438
KASP Assay ID:
554-2782.1 (used for ordering genotyping assays)
KASP Sequence:
TGGGTTCGACACCCTAACTATCTAGGAGACGTGATGATGATGTTGGCCTG[G/A]TGTCTGCCCTGCGGTACGTCWGTGTTTATCAGCAATCMCTGCAGCTGGGA
Associated Phenotype:
Not determined