Busch Lab

ZMP

zgc:172291

Ensembl ID:
ENSDARG00000075657
ZFIN ID:
ZDB-GENE-080204-71
Description:
synphilin-1 [Source:RefSeq peptide;Acc:NP_001107108]
Human Orthologue:
SNCAIP
Human Description:
synuclein, alpha interacting protein [Source:HGNC Symbol;Acc:11139]
Mouse Orthologue:
Sncaip
Mouse Description:
synuclein, alpha interacting protein (synphilin) Gene [Source:MGI Symbol;Acc:MGI:1915097]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39521 Nonsense Mutation detected in F1 DNA Not yet available
sa30482 Nonsense Mutation detected in F1 DNA Not yet available
sa30755 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39521
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109721 Nonsense 342 740 6 13
Genomic Location (Zv9):
Chromosome Zv9_NA89 (position 24793)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 263677
GRCz11 8 114498
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGAGCTTAGCTGTACCCGAGAACACCCGAGCCTCATTCATTACGCTGCT[C/T]GATACGGTCAGGTGAGCGACTGGAGAAAGCAAACACACACTCACTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30482
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109721 Nonsense 457 740 10 13
Genomic Location (Zv9):
Chromosome Zv9_NA89 (position 28715)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGTATTTCATAGCAAC[C/T]AACTTATTTTTAGATGTATTTCATAGCAACAGGCACATTTTAGATGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30755
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109721 Nonsense 526 740 13 13
Genomic Location (Zv9):
Chromosome Zv9_NA89 (position 30889)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 269611
GRCz11 8 120432
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTCATGCGGAAACTGCTGACGAAAGATGCAGCAGAGCGAACCCATCCC[A/T]GAGACACCCACGATGCAGGGGCGGAGTCAGGGGCGGGGCCAGGGGCTGGA
Associated Phenotype:
Not determined