Busch Lab

ZMP

zgc:171667

Ensembl ID:
ENSDARG00000075619
ZFIN ID:
ZDB-GENE-070928-16
Description:
centromere protein O [Source:RefSeq peptide;Acc:NP_001099172]
Human Orthologue:
CENPO
Human Description:
centromere protein O [Source:HGNC Symbol;Acc:28152]
Mouse Orthologue:
Cenpo
Mouse Description:
centromere protein O Gene [Source:MGI Symbol;Acc:MGI:1923800]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36302 Nonsense Mutation detected in F1 DNA Not yet available
sa36301 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36302
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109249 Nonsense 84 284 3 6
Genomic Location (Zv9):
Chromosome 17 (position 6297180)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6376116
GRCz11 17 6533346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATGAAGAGGATGAGGATGATGAAACTGGAGGCTTCGCAGCTCTACAA[C/T]AGTCTTTGTTAACAGCTTGGAAAATGCAGCTGAAAGATCTTCAGCACGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7818
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109249 Nonsense 134 284 4 6
Genomic Location (Zv9):
Chromosome 17 (position 6295379)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6374315
GRCz11 17 6531545
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTGTGTGTCGTTTCACACTGCCTACGAAGGTGTGTATCTGGACACRTA[T/G]AACATGGARCTGGACCTGATGCGCACCGTCCAGATCTCTCGCCATAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36301
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109249 Essential Splice Site 248 284 5 6
Genomic Location (Zv9):
Chromosome 17 (position 6292431)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6371367
GRCz11 17 6528597
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAGATCTCACACAGAGTCTCCCAACACACGTCAGCATTGAGAGTGAAG[G/A]TACAATCCAATACCAAGAGAAACTGAACTACAAGTGTGAACAAACCATGT
Associated Phenotype:
Not determined