Busch Lab

ZMP

si:dkeyp-41f9.3

Ensembl ID:
ENSDARG00000075600
ZFIN ID:
ZDB-GENE-091118-56
Mouse Orthologue:
BC067074
Mouse Description:
cDNA sequence BC067074 Gene [Source:MGI Symbol;Acc:MGI:3040697]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa21669 Nonsense Available for shipment Available now
sa34851 Nonsense Mutation detected in F1 DNA Not yet available
sa14128 Nonsense Available for shipment Available now
sa15088 Nonsense Available for shipment Available now
sa31765 Nonsense Available for shipment Available now
sa45396 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21669
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113301 Nonsense 165 2287 2 14
ENSDART00000139324 None None 303 None 5
Genomic Location (Zv9):
Chromosome 10 (position 9215992)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9291948
GRCz11 10 9125507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTCAATGAGCATAACCTTCTGTCGTCCCTTAGGCCATACTCTGGATA[C/A]AAAATGATTCATGAAGTGTCACTTGGTTGCAGTCCAGAATTCTCAGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34851
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113301 Nonsense 665 2287 2 14
ENSDART00000139324 None None 303 None 5
Genomic Location (Zv9):
Chromosome 10 (position 9214494)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9290450
GRCz11 10 9124009
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACCTTTATTAGTAACAAAAATCTTGCTATTCAAGTGAACGTCCCTAAA[C/T]AAGCAGTGGATATTCGCTATGATATCACAGTGCCACCAGTTTATGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14128
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113301 Nonsense 750 2287 2 14
ENSDART00000139324 None None 303 None 5
Genomic Location (Zv9):
Chromosome 10 (position 9214237)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9290193
GRCz11 10 9123752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCATTACTGAMGAGTTTTTATTTCTGATTAGAGTTCGCTGGATACRATA[C/A]AGAATCACCAAAAATAAGGTTGAGATAGAGGGTAAACAAAAAGTCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15088
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113301 Nonsense 1235 2287 3 14
ENSDART00000139324 None None 303 None 5
Genomic Location (Zv9):
Chromosome 10 (position 9212704)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9288660
GRCz11 10 9122219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTATTGTGTAACTGATGTGGTTTGTTTCAGGTTATTCATGAGGATAAC[A/T]AACCTTATGAATTTTTGTATACTGTGAAGGTGGCACCCGCWCATGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31765
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113301 Nonsense 1571 2287 8 14
ENSDART00000139324 Nonsense 257 303 5 5
Genomic Location (Zv9):
Chromosome 10 (position 9200665)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9276621
GRCz11 10 9110180
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCAAAGTTAATTTCGGAAGATGAGCTGCTGATTCTCACAAATGACTA[T/A]GATGATATTCATGGCAATCGCACCATCATCTACACAGTAACTTCACCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45396
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113301 Essential Splice Site 2134 2287 11 14
ENSDART00000139324 None None 303 None 5
Genomic Location (Zv9):
Chromosome 10 (position 9196516)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9272472
GRCz11 10 9106031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCATGGGCGAGTTTGTGTACTTAGTATTACCATTTGATCCCATTACAGG[G/A]AAGCATATACTTTTAGAGCCAACCAAGCTGCCAACTTTCAACATAACAAC
Associated Phenotype:
Not determined