Busch Lab

ZMP

ITFG1

Ensembl ID:
ENSDARG00000075584
Description:
integrin alpha FG-GAP repeat containing 1 [Source:HGNC Symbol;Acc:30697]
Human Orthologue:
ITFG1
Human Description:
integrin alpha FG-GAP repeat containing 1 [Source:HGNC Symbol;Acc:30697]
Mouse Orthologue:
Itfg1
Mouse Description:
integrin alpha FG-GAP repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:106419]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11345 Nonsense Available for shipment Available now
sa14935 Nonsense Available for shipment Available now
sa14164 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11345
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110907 Nonsense 266 599 9 19
Genomic Location (Zv9):
Chromosome 7 (position 43395405)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41790112
GRCz11 7 42125477
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTCCCCCTCAGACGGTGATGGCTTCCAGGACCACCTGTTGCCGGTSTG[T/A]ATGGACGATGYGTGTGCTAAAAGTGCAATATACCTGGCCAGGCCTGGGGG
Long Flanking Sequence:
TCTGCAGGGCTGCCAGTCTGATCTACATGGCTATTTGGTGTTCGGTAGACGCTATGAATGTCAATGCATATCGCCTTTTCTTTTTCTCTCTACTGTTTTTCCCTCCAGTTCTCTCCTCTCCCTCTTCAATCTATTTTTTCAAGCAAGCTGCTTTTTTATTTTGTTGATTTATTTTATTCCTCTCACCATGTCTTTTTAATATTTCATATTAATAGTAAGAGCTTGCGGTAAACATGAAGGAATAAAGACTCGGGCGCAGGATTTTGACACCAGGACAAACTGCAACACACCAGGCTGCTACACACTTCATTACACATGCTCAGGATCACATGACGTTATCTCCATATGCCCAATTCAGGAGCATTACCAACCAAATGAAAAGATGCATTAGTATGTCATAAAGCTCATTTTGCTTCCACTCTCCTGATTCATTCCCTGTTGTATTTATTTATTTCCCCCTCAGACGGTGATGGCTTCCAGGACCACCTGTTGCCGGTGTG[T/A]ATGGACGATGCGTGTGCTAAAAGTGCAATATACCTGGCCAGGCCTGGGGGGACAAAGGTACACAAGCCCTGCATTATTAGTCTGTCACACTCCTCCATCCCACATATTCATCTGTTTGCGTGTGATGTTTGGATGCAGTGAGGTTTCAGAGCTGCTTTGAGGATGGTGATTGGGCCGTTTTAAACATTTATATCACTGTGGCTTCTAAAATTGACAGATGGATTGATGTGACGGATAGATGCGTGGTAGGGCTGGGGATTGATACAGATATCCTGATTTAATTTGATTCACAAGCTGACTAAATGTCAGTTTCTCATGTGCAACTAATTTTGTAAGAGGTCACGCTGGTGCCACTGCAGATTTGCTGAACTGATAAGCGGTGACATTCTGACGTGTGCGAGGTACACTGGGAATACGCCAAAAGGGGAACGCGACTGCTGCTTGTTTGTTCTGAACTATTTTTCTGCTTGGTTTAAAAGAAAAGAGAGCACTGCGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14935
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110907 Nonsense 408 599 12 19
Genomic Location (Zv9):
Chromosome 7 (position 43458527)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41726990
GRCz11 7 42062355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCATTTGCAGGGWATATTAGATATGATCGTGCTCAGCAAGGTGGAAGGG[A/T]AAGAAGAACTCGTCATCCACGCTTTGAAGAACAACTTTGAGGCCGACGCS
Long Flanking Sequence:
GTCACCTTAAAATCTCAGACAGCCCTCGAGCATCGATGTGCACATGCGATTTCACCATCATCTCTCCTTTCCTTTTCCTCTATGATTCACTCCTTCCCTCCCTCGACCCCTTTCTCTCCATCTGTATCGCAACCTTCTCCCCATCGTAATCACAATATAGCCAATTACCTCGAATTCCCTCATGCTTACATAACTAATGGAGCTAAAGGCTCATTAAACAAACAGCACGCGCATGTCTCATTCTGTTAGCATTCCAGCTAGTCATCATTAGCACAGTATTAGGATGCTATCTGAACAGGAGCCCCCGCGCAGCCATCTTCTTAAGAACGAGACCGATAGACCGCAGAGAAGGCCTGATAAGAAGTGTAATAGCTTGCTGGAGTCCATTAAGGATATGAGTGCTCATCAGACGGGAGAGATTCAATGGGCTCGATACATTGTTTCTGATTTCTCATTTGCAGGGTATATTAGATATGATCGTGCTCAGCAAGGTGGAAGGG[A/T]AAGAAGAACTCGTCATCCACGCTTTGAAGAACAACTTTGAGGCCGACGCGTATTTCGTGAAAGTCATCGGTGAGTATTAGATGTGTGTCATTTAGTAGTGATGGGTAATGTCTTATCGTTTGGGATATATCAGTCAGTATTCTAGTCCTCCTGCAATAATAACAATAAAACTGACAATCTGAAATACAGTCTGGGGATGGTTTGGTTAGGGCTGTAAAAGTGATGAGAAAATCAGTTTGTGCAATGAATAAATGTACTACAGTAGCATGTGAATGATAAGGATTTGTGTGTGTGTTTACGAACTGTTTACAAATAATGGCATTTTGCTGGCATACAGTACATTTACTTCAAATTCATTTAGAACATCAGTTAAGTGTTTAAAATAATGTCTAATTGTTGGCAGATCTGCTTTGATATCAGAGATTAAGGAAGACTTCATACTTTTTTTTAGTAGTGTATACCAGTAGTTTCCAAAGTAGGGGTCGGGACCCCCTGGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14164
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110907 Essential Splice Site 431 599 12 19
Genomic Location (Zv9):
Chromosome 7 (position 43458598)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41726919
GRCz11 7 42062284
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTTGAAGAACAACTTTGAGGCCGACGCRTATTTCGTGAAAGTCATCGG[T/G]GAGTATTAGATGTGTGKCATTTAGTAGTGATGGGTAATGTCTTATCGTTT
Long Flanking Sequence:
CTTTTCCTCTATGATTCACTCCTTCCCTCCCTCGACCCCTTTCTCTCCATCTGTATCGCAACCTTCTCCCCATCGTAATCACAATATAGCCAATTACCTCGAATTCCCTCATGCTTACATAACTAATGGAGCTAAAGGCTCATTAAACAAACAGCACGCGCATGTCTCATTCTGTTAGCATTCCAGCTAGTCATCATTAGCACAGTATTAGGATGCTATCTGAACAGGAGCCCCCGCGCAGCCATCTTCTTAAGAACGAGACCGATAGACCGCAGAGAAGGCCTGATAAGAAGTGTAATAGCTTGCTGGAGTCCATTAAGGATATGAGTGCTCATCAGACGGGAGAGATTCAATGGGCTCGATACATTGTTTCTGATTTCTCATTTGCAGGGTATATTAGATATGATCGTGCTCAGCAAGGTGGAAGGGAAAGAAGAACTCGTCATCCACGCTTTGAAGAACAACTTTGAGGCCGACGCGTATTTCGTGAAAGTCATCGG[T/G]GAGTATTAGATGTGTGTCATTTAGTAGTGATGGGTAATGTCTTATCGTTTGGGATATATCAGTCAGTATTCTAGTCCTCCTGCAATAATAACAATAAAACTGACAATCTGAAATACAGTCTGGGGATGGTTTGGTTAGGGCTGTAAAAGTGATGAGAAAATCAGTTTGTGCAATGAATAAATGTACTACAGTAGCATGTGAATGATAAGGATTTGTGTGTGTGTTTACGAACTGTTTACAAATAATGGCATTTTGCTGGCATACAGTACATTTACTTCAAATTCATTTAGAACATCAGTTAAGTGTTTAAAATAATGTCTAATTGTTGGCAGATCTGCTTTGATATCAGAGATTAAGGAAGACTTCATACTTTTTTTTAGTAGTGTATACCAGTAGTTTCCAAAGTAGGGGTCGGGACCCCCTGGGGAGTAGCAGTACTATGGCACGGGGCCACTTGGTGATTTCCAAAACTCAAATAAATTTCCTTAAACTATTAGAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8280
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110907 Nonsense 463 599 14 19
Genomic Location (Zv9):
Chromosome 7 (position 43494860)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41690657
GRCz11 7 42026022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTGGTGTGAAMCAGCCWGGCCCGTATGTCATGTACACATCGGTGGACT[C/A]GAACGGTTATCTAAAGAACGCTTCTGGTGAGTACACGGCTCAGAAAAGAT
Long Flanking Sequence:
AAATGTGGAAGAATGAAAACAGTAGCCAGAGAGAATAATGTCTAATTTACTGTCCTGCCCCCATAGATGCTGCATTAGAAATGCCTCGCACAAGCAGTAATTCGTTTTTTGTCATTTAAAGAAAAGATGATAAAATACATTTATAAACACAAATAAATGTTCATTTATTCATTCATTCATTCATTTTCTTTTCGGCTTAGTCCCTTTATTAATCTGGGTGTTGCCACAGCTGATGCACTTCCATCTGCAACCCATCGCTGAGAAAATAAATGTTCATATGTTTTTTAAAAATATATAAATATAATAAAATCTTTCAAGGATTTAGGATGCTGATGATGGTTAATTGCATTATAACAGGCTTGTGAAAAGGGTCCATTACTATAATTGTATTTTCTAATAGTTTGATTGTCTGTGTATTTGTCGTTAATCTTTTCTATCCACCCCACAGCCCTTTGGTGTGAACCAGCCTGGCCCGTATGTCATGTACACATCGGTGGACT[C/A]GAACGGTTATCTAAAGAACGCTTCTGGTGAGTACACGGCTCAGAAAAGATTAACAGTAGATTGGAAAAAAAAACATCACATGTATCTCAACATATCCTGTCTCAGTGAGCTAAGATAAGACAACCTCAACACACTGCAGTCAATCAACTTGACAAGAATGATCTGACTAAACTCTAGTTTTGAATGAACCAGTAAAATGCTTTTCCTTGGCGTTATCATATTTTTAATTCTAATATTATCTCTCATCTTAAAAATGTCTATTATTGTTTTAACACATTCTACTTTTAAAGTAAATTACGAAAATGAAAACAAACTGGTTTGTTCTGAGCCAATTCTTCTAGATTATGTGGATCATTTGCAGTTCATTTACAGCATTATGAAAGAACATTAAAATATTGTGGCTTTAATTTATACCCATTGTCACACAATGCTCCATATACAACATTTGAAAGATTATATTTCCAATTATTTACAATCAGTATTTACCAATTAACTGTTAA
Associated Phenotype:
Not determined