Busch Lab

ZMP

si:ch73-79d13.2

Ensembl ID:
ENSDARG00000075567
ZFIN ID:
ZDB-GENE-081031-27
Description:
Novel protein similar to H.sapiens FBXL20, F-box and leucine-rich repeat protein 20 (FBXL20) [Source
Human Orthologue:
FBXL20
Human Description:
F-box and leucine-rich repeat protein 20 [Source:HGNC Symbol;Acc:24679]
Mouse Orthologue:
Fbxl20
Mouse Description:
F-box and leucine-rich repeat protein 20 Gene [Source:MGI Symbol;Acc:MGI:1919444]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15339 Nonsense Available for shipment Available now
sa36765 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15339
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110398 Nonsense 34 436 2 15

The following transcripts of ENSDARG00000075567 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5464833)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4924144
GRCz11 19 4840630
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATAATGATGAGGCTGTTATTAACAAGAAGCTGCCGAAGGAACTGCTGT[T/A]ACGGTTGGTGTGAAACCCTTKTAGTACTTYTCTGCTTCATTTCCACATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36765
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110398 Nonsense 48 436 3 15

The following transcripts of ENSDARG00000075567 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5464634)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4923945
GRCz11 19 4840431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGTCTGCAGAATTTTCTCATTTCTGGATGTAGTCACACTTTGCCGCTG[T/A]GCTCAAGTCTCACGAGTAAGTGCCTTTTAAAAAAAAGTACATTTAAAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29140
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110398 Essential Splice Site 330 436 13 15

The following transcripts of ENSDARG00000075567 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5454116)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4913427
GRCz11 19 4829913
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTACACTCATCCAGCTCTCTATACACTGCCCTCGACTACAAGTTCTGG[T/G]AAGTATTCATGAAGATTTGTACAAAGCAAAAAAGGCATGTGAATAATATT
Associated Phenotype:
Not determined