Busch Lab

ZMP

cdh5

Ensembl ID:
ENSDARG00000075549
ZFIN IDs:
ZDB-GENE-040816-1, ZDB-GENE-040816-1
Description:
cadherin-5 [Source:RefSeq peptide;Acc:NP_001003983]
Human Orthologues:
CDH1, CDH13, CDH15, CDH2, CDH26, CDH3, CDH4
Human Descriptions:
cadherin 1, type 1, E-cadherin (epithelial) [Source:HGNC Symbol;Acc:1748]
cadherin 13, H-cadherin (heart) [Source:HGNC Symbol;Acc:1753]
cadherin 15, type 1, M-cadherin (myotubule) [Source:HGNC Symbol;Acc:1754]
cadherin 2, type 1, N-cadherin (neuronal) [Source:HGNC Symbol;Acc:1759]
cadherin 26 [Source:HGNC Symbol;Acc:15902]
cadherin 3, type 1, P-cadherin (placental) [Source:HGNC Symbol;Acc:1762]
cadherin 4, type 1, R-cadherin (retinal) [Source:HGNC Symbol;Acc:1763]
Mouse Orthologues:
Cdh1, Cdh13, Cdh15, Cdh2, Cdh26, Cdh3, Cdh4
Mouse Descriptions:
cadherin 1 Gene [Source:MGI Symbol;Acc:MGI:88354]
cadherin 13 Gene [Source:MGI Symbol;Acc:MGI:99551]
cadherin 15 Gene [Source:MGI Symbol;Acc:MGI:106672]
cadherin 2 Gene [Source:MGI Symbol;Acc:MGI:88355]
cadherin 3 Gene [Source:MGI Symbol;Acc:MGI:88356]
cadherin 4 Gene [Source:MGI Symbol;Acc:MGI:99218]
cadherin-like 26 Gene [Source:MGI Symbol;Acc:MGI:2685856]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa38634 Nonsense Mutation detected in F1 DNA Not yet available
sa21048 Essential Splice Site Available for shipment Available now
sa34151 Essential Splice Site Available for shipment Available now
sa40984 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa10732 Nonsense Available for shipment Available now
sa21049 Essential Splice Site Available for shipment Available now
sa7601 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38634
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Nonsense 59 767 2 12
ENSDART00000111441 Nonsense 59 767 2 13
Genomic Location (Zv9):
Chromosome 7 (position 45444492)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44117392
GRCz11 7 44456617
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGCAGCACTTCAAAGACATAAAAGAGATTGGAAATGGGATAAACTGTA[T/A]GCGTATGAGGAAACACGACCTAAAAACCCACCTGAAAAGATTGGAAAGGT
Long Flanking Sequence:
ACTCGAACTTTTGAACTAAACGACCAGTATTGAAGTGATGTGAAGTGAATAATGGTCTTTTATATTTGACATATGTCTGTATTATTGATTATGTTACAGTGTGTTTGCATCATTGTTTTATGTTATTTCCCTCTTTAATAATGTAAAGCTGCTTTTGAAATTGCTGGTGTTTACATTTTTTATATAATTATGACTTTTGCAATAATGTCTTTCTTTCTTTCCAACATTAAAGTGTATGTACTGTATGGGTAAAGAAACCATCAACACTGCAGCACTACAAGGCATGAATTATCATACAGATATTTGTTTTGTTGTTTTCTGCAGATGATGAAACAGTGTGCCAGAAGGCAGATGACTGAGCCTGTCTTCAGGGTTGCTGTCCTGCTCGCATTATGTAGCCTCAGTATCGGAGTCGATGTCCACCAAGCTCAGAAAACACCATCTATCTCGAGTGCAGCACTTCAAAGACATAAAAGAGATTGGAAATGGGATAAACTGTA[T/A]GCGTATGAGGAAACACGACCTAAAAACCCACCTGAAAAGATTGGAAAGGTAGACGGTCTTGTAAACAAATGGATCACACTTTAATTTGGAGAGATCCGTTCACACAATTAGCTGTGATTTCTTCCACAGACAACATTACATTTGCTGTGCAATAATAGTTAATTAAAGGATTAAAGGTGACATTGGATGCTCATTTTACACAAGTTGATTCTTTAGGTTCTTAGCATATCCCCAACAGGCACACAACGTCATATGATATAGGTATTTGATTATATTTTGGTCACGATGTCAGGGGAGCAAAGTCCAATGTCAGTTTAACGTCAAATAAAGTCATAATAAGACGTCAATACAACGTAAGTATAAGTATCAGTAGACGTTGATCTTTGGCTGATTTTAGGTTGTGAAATTAACTAACCAAAGTCATCTTAACATTATAATGTGGCATCCATACACCATCTAGGTCTAACAACAGTAGATGGTGATCTTTGGTTGGTTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21048
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Essential Splice Site 75 767 None 12
ENSDART00000111441 Essential Splice Site 75 767 None 13
Genomic Location (Zv9):
Chromosome 7 (position 45444542)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44117442
GRCz11 7 44456667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGTATGAGGAAACACGACCTAAAAACCCACCTGAAAAGATTGGAAAGG[T/C]AGACGGTCTTGTAAACAAATGGATCACACTTTAATTTGGAGAGATCCGTT
Long Flanking Sequence:
AATGGTCTTTTATATTTGACATATGTCTGTATTATTGATTATGTTACAGTGTGTTTGCATCATTGTTTTATGTTATTTCCCTCTTTAATAATGTAAAGCTGCTTTTGAAATTGCTGGTGTTTACATTTTTTATATAATTATGACTTTTGCAATAATGTCTTTCTTTCTTTCCAACATTAAAGTGTATGTACTGTATGGGTAAAGAAACCATCAACACTGCAGCACTACAAGGCATGAATTATCATACAGATATTTGTTTTGTTGTTTTCTGCAGATGATGAAACAGTGTGCCAGAAGGCAGATGACTGAGCCTGTCTTCAGGGTTGCTGTCCTGCTCGCATTATGTAGCCTCAGTATCGGAGTCGATGTCCACCAAGCTCAGAAAACACCATCTATCTCGAGTGCAGCACTTCAAAGACATAAAAGAGATTGGAAATGGGATAAACTGTATGCGTATGAGGAAACACGACCTAAAAACCCACCTGAAAAGATTGGAAAGG[T/C]AGACGGTCTTGTAAACAAATGGATCACACTTTAATTTGGAGAGATCCGTTCACACAATTAGCTGTGATTTCTTCCACAGACAACATTACATTTGCTGTGCAATAATAGTTAATTAAAGGATTAAAGGTGACATTGGATGCTCATTTTACACAAGTTGATTCTTTAGGTTCTTAGCATATCCCCAACAGGCACACAACGTCATATGATATAGGTATTTGATTATATTTTGGTCACGATGTCAGGGGAGCAAAGTCCAATGTCAGTTTAACGTCAAATAAAGTCATAATAAGACGTCAATACAACGTAAGTATAAGTATCAGTAGACGTTGATCTTTGGCTGATTTTAGGTTGTGAAATTAACTAACCAAAGTCATCTTAACATTATAATGTGGCATCCATACACCATCTAGGTCTAACAACAGTAGATGGTGATCTTTGGTTGGTTAAAATTTGTAGCATTAACTAACCAAAATCCAACATCATATTAATGTCAGAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34151
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Essential Splice Site 208 767 4 12
ENSDART00000111441 Essential Splice Site 208 767 4 13
Genomic Location (Zv9):
Chromosome 7 (position 45446520)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44119420
GRCz11 7 44458645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTTCAAACTACTAAATGGCACAGACCTCTTCAAAATCAAGCCCAATGG[T/C]AACACCAAGACTGTATTTATTTGATTAGGAATGCAATATAGACAGTGATT
Long Flanking Sequence:
TTGCAAAGCTGGACCGGGAAACACAAAGTGTCTACAATCTCTCAGCTTCTCTCCTCAACATACATACTGGAGAGTTAGTTGACAAAGATGAATCATTTGTAATAGTAGTACTGGATATTAACGACAACATCCCCGTTTTCGATTCTGACCAATCTGGATCCATCAGCGAATCCTCTAGAGCAGGTAACAGACTAACACAAGCATGTGCTTGTCCATTGATGCATGTTGCTTTCTGTGTTGGCAGCATTTAGAATAATATGCAGTATTGACAAAAAAATTAACAAGAATAGACAGTTATCTGAATTAATGCAAGTAAAAAAAAAAGAATGTATCAAAAATGAAATTGTTTTTTTTTTTTCATTTTTCAAATACATTGACTTTGTAGGAACAACTATAATGAAAGTAAAAGCAACAGACGCTGATGATTCCTCCACTGAAAATGGAAGGATTGACTTCAAACTACTAAATGGCACAGACCTCTTCAAAATCAAGCCCAATGG[T/C]AACACCAAGACTGTATTTATTTGATTAGGAATGCAATATAGACAGTGATTTTACACCTATATAAAGTACATAAATAAAGTAACTGTCTAAAGTTACTTTTTTAGGTTTTATTTAAAGAAAAACTGATCTAAATTAACACATTTACAGACTTTTTTGTTTATTCATTTGAGCTACAACATACAAACAGACTGTTAGATTGAGATTGACTTAATTTAATTGTCATAAATTATTAATATGGTATTCAGTGGATGACAATATTTTGTAGGGGTTTTTTTTATTCAACTAAATAAATACACATTTGTCAATAAGCATGTATAAGATTTAATATTTCAGTACATTAAAATCAAGCACTTTTACATTTCGACTGAATTGAAACGGAGAACATCTTGATTTGTGTGCTTTGTTTGCCACTGTTTTTTTTTTTTTTTTAGGTGACCTAATAGCATTGAAAAGTGACCTCGACCGTGAGAAACAGAGTCAGTATCTTATTGCTGTTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40984
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Splice Site, Nonsense 264 767 5 12
ENSDART00000111441 Splice Site, Nonsense 264 767 5 13
Genomic Location (Zv9):
Chromosome 7 (position 45447119)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44120019
GRCz11 7 44459244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACCATCAACATAAAAGACATAAATGACAACATTGCCACCTTTAAGAAA[G/T]GCAAATAAAATAATACTTAAGCTAAACTGCATGCTACTGTATAAAGTCAG
Long Flanking Sequence:
TTTTAGGTTTTATTTAAAGAAAAACTGATCTAAATTAACACATTTACAGACTTTTTTGTTTATTCATTTGAGCTACAACATACAAACAGACTGTTAGATTGAGATTGACTTAATTTAATTGTCATAAATTATTAATATGGTATTCAGTGGATGACAATATTTTGTAGGGGTTTTTTTTATTCAACTAAATAAATACACATTTGTCAATAAGCATGTATAAGATTTAATATTTCAGTACATTAAAATCAAGCACTTTTACATTTCGACTGAATTGAAACGGAGAACATCTTGATTTGTGTGCTTTGTTTGCCACTGTTTTTTTTTTTTTTTTAGGTGACCTAATAGCATTGAAAAGTGACCTCGACCGTGAGAAACAGAGTCAGTATCTTATTGCTGTTCAAGCCAAAGACATGCCAGAACACCTGACTGGGAATTCTGCCACTACCGTTGTTACCATCAACATAAAAGACATAAATGACAACATTGCCACCTTTAAGAAA[G/T]GCAAATAAAATAATACTTAAGCTAAACTGCATGCTACTGTATAAAGTCAGCAGCACCAACAAAACATCACTTTCTTTTACAGAAAGATACCAGTTTACAGTGAAGGAAGACTTGAAACCCGGAAGTGAAATTGGCCTTTTAGAGGTGGAGGACAAAGACGAGATACAAAACAAAGATCCAACATTTGCGCTACAATCTAAATTCAATGATGTGTTTGATATTAAACGAACTAAAGAGAAAGATGGAATGCTAAGCCTCAAAGTGGTAAGTGTGTCAAATATTTTATACAAAACTAGTTATTAAACATTATTTAAGACTGAGCCATGTTGTTTACTTGGACTTTTTTTTTTTTGAAACACTTACAGCCTCTTGACTATGAAAAGGAGAAGACACACAAGTTTATCGTAATTGTGGAAGAACACACAGTATCGAGAACACCTGATAACAAAGGGCTGTTGAAGAGAACCGAAGTAATCATTGATGTAACTGATGTTGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10732
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Nonsense 484 767 9 12
ENSDART00000111441 Nonsense 484 767 9 13
Genomic Location (Zv9):
Chromosome 7 (position 45449312)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44122212
GRCz11 7 44461437
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTAATGACAATGCACCAGAACTAACCAATGGGAGCTACGTGTATGTCTG[T/A]GAGAATGATAAACCTAACACAGTAAGGAGTTGTTCTAATGCATTTCATAT
Long Flanking Sequence:
TGTATAGTGGAAGAATCACAGGCATGCTGAATTAGTGCTGGCTAAATGGTCTGTTAATCGTGAATTCGCTTCAAGAAACCCATAAGAATAGGACTTCTGGGAACTGTTTTGTTTGCAGTGCTAAATATTATGTATATTTGTATAATTATAATTGTTAAATATTATAATTTTGTTATTATATTATATATTTTTTTAATCTTTACTTTTTTTATACATTAATTACCAAAGAACCCTAACTAAACAATGGTAAGATGTAAACTTATGGAGTACAAATACTGTATGTTGGTAGAATACTATTGTTGGTACAATAGTAGCATGCTGTGTATGAGACAAGATTAATAATCATCATCCACAGATGATTTATATGTCTTTATATCTTATATATTAATTTTTTGCTCTGAATCCGCAGGTCTTAAATCCTCTACTATGGTTAGCCTGAAGGTTCTGGACATTAATGACAATGCACCAGAACTAACCAATGGGAGCTACGTGTATGTCTG[T/A]GAGAATGATAAACCTAACACAGTAAGGAGTTGTTCTAATGCATTTCATATGAACACATGTATAACGATTGACCTTTAGAAAATATCTGTATTCATTCATTGCTCTCTTGCAGATAATTGGGACTATTGGTGCCTCCGACAAGGATGAAAATTCAGGCAGGTTTCGCTTCACTCTTGCAAGAAAGAGCTCAAACTTTTCCCTCTATGATAACCAAGGTGGGTTACTAAAGATCATTCACAGAGTGCTTATAAATTGTTACTATAACTGTAATCAATCACATTATAGATTGCTTAATTTGAATAAGTGTGAATGCAGCTATCCCACTCTTAGTGTGCAAACAGACCAAAACCACTAAAAAGATGGATCTTGCTCTGTTTAATAGGAAGTCTGGATTGGTTTAATAGAAATATAAATGCAAAGCATATCAAATACATAAAAGTAGACCAAAAAACAACACAGGAAGTCACATATTATTACATATACGGATTTTTATTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21049
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Essential Splice Site 492 767 10 12
ENSDART00000111441 Essential Splice Site 492 767 10 13
Genomic Location (Zv9):
Chromosome 7 (position 45449424)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44122324
GRCz11 7 44461549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACGATTGACCTTTAGAAAATATCTGTATTCATTCATTGCTCTCTTGCA[G/A]ATAATTGGGACTATTGGTGCCTCCGACAAGGATGAAAATTCAGGCAGGTT
Long Flanking Sequence:
TTGCAGTGCTAAATATTATGTATATTTGTATAATTATAATTGTTAAATATTATAATTTTGTTATTATATTATATATTTTTTTAATCTTTACTTTTTTTATACATTAATTACCAAAGAACCCTAACTAAACAATGGTAAGATGTAAACTTATGGAGTACAAATACTGTATGTTGGTAGAATACTATTGTTGGTACAATAGTAGCATGCTGTGTATGAGACAAGATTAATAATCATCATCCACAGATGATTTATATGTCTTTATATCTTATATATTAATTTTTTGCTCTGAATCCGCAGGTCTTAAATCCTCTACTATGGTTAGCCTGAAGGTTCTGGACATTAATGACAATGCACCAGAACTAACCAATGGGAGCTACGTGTATGTCTGTGAGAATGATAAACCTAACACAGTAAGGAGTTGTTCTAATGCATTTCATATGAACACATGTATAACGATTGACCTTTAGAAAATATCTGTATTCATTCATTGCTCTCTTGCA[G/A]ATAATTGGGACTATTGGTGCCTCCGACAAGGATGAAAATTCAGGCAGGTTTCGCTTCACTCTTGCAAGAAAGAGCTCAAACTTTTCCCTCTATGATAACCAAGGTGGGTTACTAAAGATCATTCACAGAGTGCTTATAAATTGTTACTATAACTGTAATCAATCACATTATAGATTGCTTAATTTGAATAAGTGTGAATGCAGCTATCCCACTCTTAGTGTGCAAACAGACCAAAACCACTAAAAAGATGGATCTTGCTCTGTTTAATAGGAAGTCTGGATTGGTTTAATAGAAATATAAATGCAAAGCATATCAAATACATAAAAGTAGACCAAAAAACAACACAGGAAGTCACATATTATTACATATACGGATTTTTATTTATTTTTTTTATCCTTAAATCAGGTCATTGAAAACAGTAAAAATTAAGAAATGAACTTCATGTGTGAGCACAGCGTAAAATTTAAATCCATATTCCCTGTCCTTCTGCTCATCATAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3640
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Essential Splice Site 526 767 10 12
ENSDART00000111441 Essential Splice Site 526 767 10 13
Genomic Location (Zv9):
Chromosome 7 (position 45449529)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44122429
GRCz11 7 44461654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCACTCTTGCAAGAAAGAGCTCAAACTTTTCCCTCTATGATAACCAAGG[T/C]GGGTTACTAAAGATCATTCACAGAGTGCTTATAAATTGTTACTATAACTG
Long Flanking Sequence:
AATTACCAAAGAACCCTAACTAAACAATGGTAAGATGTAAACTTATGGAGTACAAATACTGTATGTTGGTAGAATACTATTGTTGGTACAATAGTAGCATGCTGTGTATGAGACAAGATTAATAATCATCATCCACAGATGATTTATATGTCTTTATATCTTATATATTAATTTTTTGCTCTGAATCCGCAGGTCTTAAATCCTCTACTATGGTTAGCCTGAAGGTTCTGGACATTAATGACAATGCACCAGAACTAACCAATGGGAGCTACGTGTATGTCTGTGAGAATGATAAACCTAACACAGTAAGGAGTTGTTCTAATGCATTTCATATGAACACATGTATAACGATTGACCTTTAGAAAATATCTGTATTCATTCATTGCTCTCTTGCAGATAATTGGGACTATTGGTGCCTCCGACAAGGATGAAAATTCAGGCAGGTTTCGCTTCACTCTTGCAAGAAAGAGCTCAAACTTTTCCCTCTATGATAACCAAGG[T/C]GGGTTACTAAAGATCATTCACAGAGTGCTTATAAATTGTTACTATAACTGTAATCAATCACATTATAGATTGCTTAATTTGAATAAGTGTGAATGCAGCTATCCCACTCTTAGTGTGCAAACAGACCAAAACCACTAAAAAGATGGATCTTGCTCTGTTTAATAGGAAGTCTGGATTGGTTTAATAGAAATATAAATGCAAAGCATATCAAATACATAAAAGTAGACCAAAAAACAACACAGGAAGTCACATATTATTACATATACGGATTTTTATTTATTTTTTTTATCCTTAAATCAGGTCATTGAAAACAGTAAAAATTAAGAAATGAACTTCATGTGTGAGCACAGCGTAAAATTTAAATCCATATTCCCTGTCCTTCTGCTCATCATAGTGTAATCAGGCATAAGAAGAATAAAACAAAAACACACCAGAGCACTGCAAAATGCATTAGGTACAAGCCACTGAAAGCAGCAGACCTGCACAGTGAATCTGTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7601
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108766 Missense 691 767 12 12
ENSDART00000111441 Missense 691 767 12 13
Genomic Location (Zv9):
Chromosome 7 (position 45454844)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44127744
GRCz11 7 44466969
KASP Assay ID:
554-4108.1 (used for ordering genotyping assays)
KASP Sequence:
TGCCATGGTMAAGAAACCTCCTGCTTGTAAGGGTGACATGGCCATGATGA[T/A]CGAGGTGAAGAAGGACGAGGCAGATCGTGATCGAGATGGCATTCCCTATG
Long Flanking Sequence:
TTACCCATCGTACTTTATCATCATTGTATAGTTTAATTTGTTTAAAACCTTTAACTAACTCTAAACATACATATAAAATAAAGGACTATTCTAAATATTGCTGGGGTTGGGCTTTGCAGCCTATAGGTCAATATCATGACAGTCAGGTGATAAATCCCTTACATCAGGGGTGCTCAACCCTGTTCCTGGAAATCTACCTTTCTGCAGTTTTAAAATAATATTAATTGTGCTTATTTTTCTCTGTTTAGTAATCGTAATCCTCATTGTGTTGAGACGGCGCTATCAGAAAGAAGTTCTTGTCACCAAGGCATCTGGCGAAATCCATGAGCAGCTGGTGAGATATGACGAGGAGGGCGGAGGAGAAATGGACACCAATGGCTACGATGTCTCCATCCTGTCTTCTGCCTGTCACGATAGCAGCTTTCGGCCCAGTGTGGGACCTGCACTTTATGCCATGGTCAAGAAACCTCCTGCTTGTAAGGGTGACATGGCCATGATGA[T/A]CGAGGTGAAGAAGGACGAGGCAGATCGTGATCGAGATGGCATTCCCTATGACACATTACACATCTATGGCTATGAGGGAACCGAATCACTAGCTGGTTCCCTCAGCTCTTTGGACTCGTCGTCCAGTGGGTCTAACCTGGATTATGATTTTATACATGAGTGGGGACCTCGGTTCAGGACCCTGGCTCAGCTTTATGGAGTAGACGGCTCTGATTCGGATAGCTCCTACTGAAGTCCATGGTCATCATCAGCTTGATGGAGACTGTGGTTTTCTCTTCATGGGAATTTTAGTAAGCATCCCATGCTACCGCTTTTTGAAAGAAAGTGCCAATATGTGTTTTTCCTCCATGCATTGTTATAATGAGCACTACTGTATTTGAAATCTACAAAGAATAAAGGGCCATTCACACCAAGGATGATAACTAGCGATAATAATAGTGATGTCAGTCTATAAATCATTTTATGAAAGAACTGATTAAGTTTTTCCTTAATCATTCAAG
Associated Phenotype:
Not determined