Busch Lab

ZMP

mmp17b

Ensembl ID:
ENSDARG00000075547
ZFIN ID:
ZDB-GENE-081107-17
Human Orthologue:
MMP17
Human Description:
matrix metallopeptidase 17 (membrane-inserted) [Source:HGNC Symbol;Acc:7163]
Mouse Orthologue:
Mmp17
Mouse Description:
matrix metallopeptidase 17 Gene [Source:MGI Symbol;Acc:MGI:1346076]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42456 Nonsense Mutation detected in F1 DNA Not yet available
sa2748 Nonsense F2 line generated Not yet available
sa2760 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa42456
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108791 Nonsense 64 613 2 11
ENSDART00000144588 Nonsense 64 482 3 11
Genomic Location (Zv9):
Chromosome 14 (position 52573079)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49836670
GRCz11 14 48824427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGTTTTGGTGTGTTCTGTTTCACAGGATTGGCTCACAAAATATGGATA[T/G]CTCCCGCCTCCTGACCCCTCAACGGGTCAGTTACAGGCCTGGACAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2748
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108791 Nonsense 546 613 11 11
ENSDART00000144588 Nonsense 452 482 11 11
Genomic Location (Zv9):
Chromosome 14 (position 52554638)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49855111
GRCz11 14 48842868
KASP Assay ID:
554-2843.1 (used for ordering genotyping assays)
KASP Sequence:
CCTCGTCTTTCAGCCTCTGATTGGCTGGATTGCCCTCAGGRCTCCTCCTA[C/A]AGTTCCGCCGACATCTCTCTCATCTCGCAGTTTGGCCAAYAGGAGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2760
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108791 Nonsense 560 613 11 11
ENSDART00000144588 Nonsense 466 482 11 11
Genomic Location (Zv9):
Chromosome 14 (position 52554598)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49855151
GRCz11 14 48842908
KASP Assay ID:
554-3042.1 (used for ordering genotyping assays)
KASP Sequence:
RCTCCTCCTAMAGTTCCGCCGACATCTCTCTCATCTCGCAGTTTGGCCAA[C/T]AGGAGCTGCACGAACAGAAAAAGCAAACAATCATCAACCAGATCAGACAC
Associated Phenotype:
Not determined