Busch Lab

ZMP

si:ch211-267e7.3

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39808 Missense, Nonsense Mutation detected in F1 DNA Not yet available
sa19725 Essential Splice Site Available for shipment Available now
sa38322 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39808
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114199 Nonsense 100 963 3 18
ENSDART00000132959 Nonsense 92 299 3 8
ENSDART00000136373 Missense 17 204 1 6
ENSDART00000138913 None None 158 None 2
ENSDART00000144534 None None 395 None 8
Genomic Location (Zv9):
Chromosome 2 (position 20357128)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20929738
GRCz11 2 20587710
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGACCCAAAACATCAACAGTTCTTTCTGCATTGGACCTTCAAAACAGTA[T/A]CAGCTGTGCACAAATCAGGTACAACCTAATGCTTAAAGGCGTTTTCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19725
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114199 Essential Splice Site 189 963 5 18
ENSDART00000132959 Essential Splice Site 181 299 5 8
ENSDART00000136373 Essential Splice Site 71 204 2 6
ENSDART00000138913 None None 158 None 2
ENSDART00000144534 None None 395 None 8
Genomic Location (Zv9):
Chromosome 2 (position 20356357)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20928967
GRCz11 2 20586939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGGACGGCATTTACCAGGGGGTTTGCATTGAAGGCCAGTGTCAGG[T/G]GTGTCACCGTTGCAAAGTACACTGTCAAAAAAATGTTGGTTCTACGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38322
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114199 Essential Splice Site 816 963 15 18
ENSDART00000132959 None None 299 None 8
ENSDART00000136373 None None 204 None 6
ENSDART00000138913 None None 158 None 2
ENSDART00000144534 Essential Splice Site 248 395 5 8
Genomic Location (Zv9):
Chromosome 2 (position 20337758)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20910368
GRCz11 2 20568340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGCGACAAAAACTGCCCCGCTCACTGGGTGGAGCAGGAGTGGGAACAGG[T/C]GAGATGCTCATTTACTATAAGCTGCAATTTATGAACAACACTCTAAAAAA
Associated Phenotype:
Not determined