Busch Lab

ZMP

suv420h2

Ensembl ID:
ENSDARG00000075461
ZFIN ID:
ZDB-GENE-080523-2
Description:
suppressor of variegation 4-20 protein-like 2 [Source:RefSeq peptide;Acc:NP_001091656]
Human Orthologue:
SUV420H2
Human Description:
suppressor of variegation 4-20 homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:28405]
Mouse Orthologue:
Suv420h2
Mouse Description:
suppressor of variegation 4-20 homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2385262]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa17369 Nonsense Available for shipment Available now
sa20036 Nonsense Available for shipment Available now
sa33199 Nonsense Available for shipment Available now
sa20035 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17369
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109104 Nonsense 70 2065 3 9
ENSDART00000113053 None None 37 None 2
ENSDART00000121907 Nonsense 70 2065 2 8
ENSDART00000124458 Nonsense 70 519 3 9
Genomic Location (Zv9):
Chromosome 3 (position 31031051)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30749090
GRCz11 3 30879932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGCGGTTCAAGCGCACGCATGACTTCCAAGCCAYCTTTGATGCTCTGT[T/A]GGATGGAGAGTGGGTYAGCGACTATTTCGCTGGGCTGGGTTCACACCGRC
Long Flanking Sequence:
TCTTCAATCAGGGCATATACAATGCACAACACAAAAAGAATGAAAGTCTCTCTATTTTGTTTTTCAATGCGAATATTTAAATATTAAATCAAGATAAATTTACTGGAGATTAAAAACAAAGTTTTTTTTTTTTTTTTTAAAAAGGAAATAAATAGATTTAAAGCTTTATACAAGAGCAAAAGTGTGAATGGATTTTTCTAAACTCACTGGCAGTTATTTATTTATTAATCTATTTGTGAGAAACATAAATACAACATGAATACATACAAACACAGTACATTTTGGGGAACAATTATTTAAATAAAAAAAATCTATTTCCCAAAATGTATTATTATCATAAGGCTGTTAAAAATGTATTGCATAATAAATGTTATCTCTACTTTATAATTCTTTCTTTGATGCAAGTACTCCCCCTGAGATCCGGCGATGGGGGTACCTCAGAGAGACACTCCTGCGGTTCAAGCGCACGCATGACTTCCAAGCCACCTTTGATGCTCTGT[T/A]GGATGGAGAGTGGGTCAGCGACTATTTCGCTGGGCTGGGTTCACACCGACAGGAGCTGTTGAAGCAGCACGTGAGTATCATGTTTAATCTAGAATAGCGTAACAATCATCCTTTCCTGTTTCTACACAGAGAGTTTTGTCTATGTGGCTGTTCAAGTCTAGTGTTGTAAATGATGGTTTGGCTTCACTTAAAACATGATAGTGTTTGGTGGATTAGGTGTTTGCTGTCTTGATGAATACAGTCTCTTCACTTATTTAAATGGGCTGAATTTAATTGCAGTCTTTGATTAATAATCACGCAATTTTCCAAGAACAGAACATTTTAAGGGATAGGATTAGACTTTTGCTATTAAATTTTCTTTGCTGAGCACCCATGATACCACAGAGCAGAAGCGAATCCTTTCTTTATTTGTTTTTTCATTTATTCTTCTGCTAGTCTGTTTGTTTTGTGCTCACTCCATAAGCGATGTGGGTTCCTTGTATAATTTGCAGTGGTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20036
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109104 Nonsense 1056 2065 9 9
ENSDART00000113053 None None 37 None 2
ENSDART00000121907 Nonsense 1056 2065 8 8
ENSDART00000124458 None None 519 None 9
Genomic Location (Zv9):
Chromosome 3 (position 31022594)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30740633
GRCz11 3 30871475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATCCTAGAAGTGAAACATCCAAAATTAGGAAAAGAGTCAAATACATCT[T/A]GGAAGAGGATAACCAAGTGGAAAATGAGAAAGAAGTTGAAGAAAGAACAA
Long Flanking Sequence:
AGAGAAAAAAGACAAGCATGATACACTTAAAAACAAATGTGAGCATCCTAGTCAGGGACTCACTGCAGCTAATCAGCCAAATAAAGATGACACTTCAATTTCGTTGGAGCCTTCGTCCATGTGCATGGTGTCTCTGGATAATAGTCCCCAGAGCAGTATTCCCCTAAAGAAACGTCAGTTTCGAGAATCAGTGGACACCGACCCAGAACAGGATGTTAATGTAGCTGCAACACTGTGTACAGATGGCAGTAATGACACTGAGCCCAACTCGGACAATCTGTTACCTAAGCCTCGTGAAGGAGGCCATTTGGAATCAAGTTTAACTTATAAAGACAATGTTGGTGTTGAGTCCAAAAAATGTGGCTCGTCCAAGTTGTTAAAGACTTTGCCAAAACGATGTTGTAAAGGTCTTCAAAGTGCTCAGCATGACCCAGCGAGAAGGACAATCAATGATCCTAGAAGTGAAACATCCAAAATTAGGAAAAGAGTCAAATACATCT[T/A]GGAAGAGGATAACCAAGTGGAAAATGAGAAAGAAGTTGAAGAAAGAACAAAGGCACCTAGGAACTCTAAGACTGGACTTTATATAGAAGATGCCAGAAATGAGTCGACTACCTCAGATGACAAGTCTGAAGAAGATCAGAGGTTAAATGTCAGAATCCGCCTTAAGAGAAAAAGAGGAAAAGAGTGGGAAATGGAAAGTACAGATGAAGCAGAAGGTGTTGTAGACAAATCAAACCCTTTGTCTTTAGTTGACCCCTTTAGGGCCATTTTGGATTCAGTCTCAATTTTAAATGCAGAAATGGAGAGGATTAGGGGTCATGGGGAGGACGATAATGGTATAGGGTTGGAGAAAGCCACCAAAGCAGTCCAAGATGTGCTAGAGCATTGTAGAAAAGAATGTGCAACTAAGCCATGTAAAAGACAGCAAAAAGCGTCAACTGTTGGAATTCGAAACAGAAATCTTAACACACCAAAAGAAACTGTTCAAGACAGTAGTAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26082
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109104 Nonsense 1453 2065 9 9
ENSDART00000113053 None None 37 None 2
ENSDART00000121907 Nonsense 1453 2065 8 8
ENSDART00000124458 None None 519 None 9
Genomic Location (Zv9):
Chromosome 3 (position 31021404)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30739443
GRCz11 3 30870285
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTTGACTTTCCTTGTTTAAATCTGGAAAACTACGATCAGATGCCTGCA[C/T]AAAACAGCTTGGCTAACACCTTAATTGATTACTGCCCTGGCGAACCACAT
Long Flanking Sequence:
CTTCTAAACCAGCAATACTGGAACAGACACTGCTGTGTAAAGTTAAAGAGGAAAAGCCGTCACCATGTCAGAAAATAAATGCAGCTCGTAGCAGCACCAAGGGTACAGAGACATTCAAAGATCCAGTGAGTTTTGAGACTTCACCTTTACCATTATCCCTTTCACCTTTGTCGCTTTACTCTCCCTGTTATGATGGACTCACGGGAGTTGGTAAAGTCAGTGGAAGTATTCAAGCAAAAGAGAATGAAAATAAAGGAAAGAATGACACTTCTTTGAGCCACAATTTGCTTCAGATTAATAAAAGTCTGTCAAGACTCCAAGCTCTGAGTCACCCGCAGGTATGCGAGAAAAGTGTGCCAACCAACACTAGTACAACCTCTTCTCAGATTCAGTCCCCACCTATATCTCCATTTACAACAGAGTGCAGCTTTAGTAACTATTCTGAGGATGTACTTGACTTTCCTTGTTTAAATCTGGAAAACTACGATCAGATGCCTGCA[C/T]AAAACAGCTTGGCTAACACCTTAATTGATTACTGCCCTGGCGAACCACATAATACAGGATCCTTCAGTAGCCCTTTCTCCCAAAGTCCTGCTGATGCGTGGAATCCAGAGACTCCTTACCTTGGATCCCCAAGTCCAGTGAGTAACTTTAGTAGTGGTGATGACCTAAACTTCCCAGACATTGTCTTTGCTCAGTCTGAAACGTCCTCTTCTGTCGGTGCTCCTCAAATGGTCTTCAAAGATAGATCATGTAATTCTGCCACAAGTTCTGCTCCTCTTCAAGACCCTGAGAAAAATCTGTACTTATCTGATGGTGAGTTGTCCAAAAGTCCCATAGAGCTTCAGGTTCAGGAAAATTCAGCAACAGCGTTTCTTCCAAAAGACTTGTCAATATTTAACAATGCAAATGCTAAACAGGCCATTCACACAGCTGGGCGTTTATATCCTCAGGATAGAAAGTTAAACTTTCTTGATTCCATTGTTAAGTCTTCAGAGGCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33199
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109104 Nonsense 1486 2065 9 9
ENSDART00000113053 None None 37 None 2
ENSDART00000121907 Nonsense 1486 2065 8 8
ENSDART00000124458 None None 519 None 9
Genomic Location (Zv9):
Chromosome 3 (position 31021303)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30739342
GRCz11 3 30870184
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATACAGGATCCTTCAGTAGCCCTTTCTCCCAAAGTCCTGCTGATGCGTG[G/A]AATCCAGAGACTCCTTACCTTGGATCCCCAAGTCCAGTGAGTAACTTTAG
Long Flanking Sequence:
GGTACAGAGACATTCAAAGATCCAGTGAGTTTTGAGACTTCACCTTTACCATTATCCCTTTCACCTTTGTCGCTTTACTCTCCCTGTTATGATGGACTCACGGGAGTTGGTAAAGTCAGTGGAAGTATTCAAGCAAAAGAGAATGAAAATAAAGGAAAGAATGACACTTCTTTGAGCCACAATTTGCTTCAGATTAATAAAAGTCTGTCAAGACTCCAAGCTCTGAGTCACCCGCAGGTATGCGAGAAAAGTGTGCCAACCAACACTAGTACAACCTCTTCTCAGATTCAGTCCCCACCTATATCTCCATTTACAACAGAGTGCAGCTTTAGTAACTATTCTGAGGATGTACTTGACTTTCCTTGTTTAAATCTGGAAAACTACGATCAGATGCCTGCACAAAACAGCTTGGCTAACACCTTAATTGATTACTGCCCTGGCGAACCACATAATACAGGATCCTTCAGTAGCCCTTTCTCCCAAAGTCCTGCTGATGCGTG[G/A]AATCCAGAGACTCCTTACCTTGGATCCCCAAGTCCAGTGAGTAACTTTAGTAGTGGTGATGACCTAAACTTCCCAGACATTGTCTTTGCTCAGTCTGAAACGTCCTCTTCTGTCGGTGCTCCTCAAATGGTCTTCAAAGATAGATCATGTAATTCTGCCACAAGTTCTGCTCCTCTTCAAGACCCTGAGAAAAATCTGTACTTATCTGATGGTGAGTTGTCCAAAAGTCCCATAGAGCTTCAGGTTCAGGAAAATTCAGCAACAGCGTTTCTTCCAAAAGACTTGTCAATATTTAACAATGCAAATGCTAAACAGGCCATTCACACAGCTGGGCGTTTATATCCTCAGGATAGAAAGTTAAACTTTCTTGATTCCATTGTTAAGTCTTCAGAGGCAAGCCTTGCTAAAATTGAGGCTAAAGATAAAACTCACGGACCTCTCAATTTACATAACTCGAGTGCAAAATCTGAATCTGTTTTTCCAAGTCAGACAACACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20035
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109104 Nonsense 2063 2065 9 9
ENSDART00000113053 None None 37 None 2
ENSDART00000121907 Nonsense 2063 2065 8 8
ENSDART00000124458 None None 519 None 9
Genomic Location (Zv9):
Chromosome 3 (position 31019572)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30737611
GRCz11 3 30868453
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACTGAGGCTTGTGGTGACTGACGGTACAGTGGATCTGGACCTACAATA[T/A]ACCGATTAATAATGACGTCTTTTATTGATATGCTGACATTTATTTATTTA
Long Flanking Sequence:
GTGTCACAGCACAACAGTCCTCATCTGGGCTACAGAGAATCTCTGATCCATGAGGCCCCACTAAGTAAAACACAGTCATCCACTTTTGAAAACAGTCAACATCCTCAACAGTCTTATGTTGTGAACTTCACCGGAGATCATTCTCTCACCCTTGGATACAGCGAGGATGGTGAACGCTCGAATTACACTGGTTCAGGTCCTGCAAATTACACTTATCATTGTCTTATGGAGCCTTCAGGAACTCAAGGAAGGCTGGTTGTTGAAGCGTGTGGTCCCTCAAACTTCTCGCCTTCTACACCTGTGAGTAGGTGTCCTGGGTCTAAAGTCCATGGAGGCCAAATTTGTAAGGATCCTCAGCAGACTCAGCAGCCTGGAACTCACCCATATAATTCTGTACACTTTACCACCTCCCACTCTCAAAGCACCCCCATAACAGATCGCAAGCCTAAGAGACTGAGGCTTGTGGTGACTGACGGTACAGTGGATCTGGACCTACAATA[T/A]ACCGATTAATAATGACGTCTTTTATTGATATGCTGACATTTATTTATTTAAATCGACTTCAGTGTAATAAGGTGTTCTGTTTGTTTTTCATTAAACTTGTATGGATCGTCCAGTTCTTAGCATTAAAGCAGAATTTTTCTTGAAATATTTAAAGACATATTTTTATTAGCAAACTTGATTGCTTAATTACTTGTATGCTGCATTTAATGTTTTAGTACATTACATATAGAAGATCATATTTTTCATGCTAGTGGTTCCTGTAAATATTATAACAGGAAAAATGGATGTTCTGTTCACCCTGTAGTACATAATACTTGCCACATGATGGTGGTGCGGTTCTCCACCACATGGAAATTCACTCGATTTCCTCATAGCCTTTTGAGTTCAGAGTTTGTAATCTAGATTGCTGTTGTTAAGAGTTTGTATGTGTGGCAACTTTCATAGTTCAGTGGGTTTGCACATGAAGGACCAGAGCATGGTTCATCTGATTTCTTAAATGT
Associated Phenotype:
Not determined