Busch Lab

ZMP

si:ch73-149o12.1

Ensembl ID:
ENSDARG00000075446
ZFIN ID:
ZDB-GENE-041111-190
Human Orthologue:
NAA25
Human Description:
N(alpha)-acetyltransferase 25, NatB auxiliary subunit [Source:HGNC Symbol;Acc:25783]
Mouse Orthologue:
Naa25
Mouse Description:
N(alpha)-acetyltransferase 25, NatB auxiliary subunit Gene [Source:MGI Symbol;Acc:MGI:2442563]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41574 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34814 Essential Splice Site Available for shipment Available now
sa21640 Nonsense Available for shipment Available now
sa38772 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21639 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41574
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Essential Splice Site 20 975 1 24
Genomic Location (Zv9):
Chromosome 10 (position 3401699)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3393893
GRCz11 10 3394197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGGCCATGTGCAAGACCCTAACGACAGGAGGCTACGACCTATCTACGG[T/A]AAGATAAAAACCGCACCGTGGGGCTGATGGAGACCCTGCTGGTCTCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34814
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Essential Splice Site 95 975 3 24
Genomic Location (Zv9):
Chromosome 10 (position 3393533)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3385727
GRCz11 10 3386031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAACTCTCTACAGGCACTGACCATCCTCTACAGAGAGATGCACCGACG[T/G]AAGTGATCACGGACCATCAAGGCATGTTTTGCATTGTATAACAGTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21640
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Nonsense 550 975 15 24
Genomic Location (Zv9):
Chromosome 10 (position 3379678)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3371872
GRCz11 10 3372176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTTAAATATTATCCATTCTGTGTTTCCAGGTATTTATTGACCCGCTA[T/A]GCAGAGTCTTTGGGCCAGTTTGCTGCTGCTTCCCAATCTTGTAACTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38772
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Essential Splice Site 577 975 15 24
Genomic Location (Zv9):
Chromosome 10 (position 3379595)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3371789
GRCz11 10 3372093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAATCTTGTAACTTCTCCCTCAGGTTTTTTCACTCGAACCAGAAAGATG[T/A]ATGCTTATTTTCTGTTTTAAATGCTTTCATCTGTATGGCAAATCTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21639
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111241 Nonsense 963 975 24 24
Genomic Location (Zv9):
Chromosome 10 (position 3373645)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3365839
GRCz11 10 3366143
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGGTGCAGAGCAGCTACCTGCGTTCGCTGCAAGAGATCGGGGAACTGT[T/A]GAAGAAGAGAGCGGACTCGTTGAAATCCCTCAAAATCTGAGCGCTCCGTC
Associated Phenotype:
Not determined