Busch Lab

ZMP

zgc:175107

Ensembl ID:
ENSDARG00000075417
ZFIN ID:
ZDB-GENE-080220-38
Description:
Zgc:175107 protein [Source:UniProtKB/TrEMBL;Acc:A8WGS6]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31407 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26352
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110261 Nonsense 64 333 3 3
Genomic Location (Zv9):
Chromosome 4 (position 58316827)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70874783
GRCz11 4 72535887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAGCATGACAAACGTGACTCCGCAATTGGCGAAAAATCCACACATACT[C/T]AAGACGCTTCCTTACTAAAAAGGCCCCAGAGCGCTGAATCCAGCGGTTAT
Long Flanking Sequence:
TCTGACTATTTTTTCTCATGTCAGGTCTTACAGGGTTAATAACCTAAGAAAGCATTTAGATCCCACCACAACTTGTTCCGTCATCATTATGTTTTACAGGGAAGCCGAAATGCTTTCATAAACATGATTTAAATGACGCGGGAGGCGATCTCTCTGCAGTTGTTCTAAATGTTGAATAAACCTACAAGCGTGATCTGTTACACCCCTAGTGAAGTATGTAGTTATTTAGCCGTTTATGCTAACTTTTCAGCTCGTACTGGCTGTCAGCAATATTATAAAGTGTTGTCCTGTTCAAACAAAGTTCTTATATATGTTTCTATAGTTCACCATTTAATAGCATGTGTTCCTCTCTTGTCTTTAAATGATTATTGATATATTTATTATGTCTTGCTTTAGACCTGACGGCACCGAAAGTGGAGCGCCAAGAAACGAATGAATTGGAAGAAAGAAATCAGCATGACAAACGTGACTCCGCAATTGGCGAAAAATCCACACATACT[C/T]AAGACGCTTCCTTACTAAAAAGGCCCCAGAGCGCTGAATCCAGCGGTTATTATATCTGCGGCGAGTGTAACAAGTCCTTCGGTCTAAAACAAAACCTGGAAGTTCACAAGAGAACCCACACCGGAGAGAAACCGTTCTCCTGCCAGCAGTGCGGCAAGAGTTTCTCTCAAAAGCAGAACCTGAAAGTGCACATGAGAGTTCACACCGGAGAGAAGCCCTTCAGCTGCCCGTTCTGCGGCCAGAACTTCACGCACAAAGGAAACCTCAAAACCCACGTGAGGAATCACACCGGCGAGAGCGCCTTCATCTGCAACCTCTGTGGCAAGAGCTTCTCCCGGAAGGAGAGTCTGAACACTCACATGAGGATTCACTCCGGAGAGAAGCCGTTCGGCTGTGCTCAGTGCGGAAAGTCGTTCAGATGCAAGGTAAATCTGAATTGCCACATGAGGATCCACTCGCGGGAGAGCAGCTTCATCTGTCATCACTGTGAACAGAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31407
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110261 Nonsense 81 333 3 3
Genomic Location (Zv9):
Chromosome 4 (position 58316774)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70874730
GRCz11 4 72535834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGCTTCCTTACTAAAAAGGCCCCAGAGCGCTGAATCCAGCGGTTATTA[T/A]ATCTGCGGCGAGTGTAACAAGTCCTTCGGTCTAAAACAAAACCTGGAAGT
Long Flanking Sequence:
ATTTAGATCCCACCACAACTTGTTCCGTCATCATTATGTTTTACAGGGAAGCCGAAATGCTTTCATAAACATGATTTAAATGACGCGGGAGGCGATCTCTCTGCAGTTGTTCTAAATGTTGAATAAACCTACAAGCGTGATCTGTTACACCCCTAGTGAAGTATGTAGTTATTTAGCCGTTTATGCTAACTTTTCAGCTCGTACTGGCTGTCAGCAATATTATAAAGTGTTGTCCTGTTCAAACAAAGTTCTTATATATGTTTCTATAGTTCACCATTTAATAGCATGTGTTCCTCTCTTGTCTTTAAATGATTATTGATATATTTATTATGTCTTGCTTTAGACCTGACGGCACCGAAAGTGGAGCGCCAAGAAACGAATGAATTGGAAGAAAGAAATCAGCATGACAAACGTGACTCCGCAATTGGCGAAAAATCCACACATACTCAAGACGCTTCCTTACTAAAAAGGCCCCAGAGCGCTGAATCCAGCGGTTATTA[T/A]ATCTGCGGCGAGTGTAACAAGTCCTTCGGTCTAAAACAAAACCTGGAAGTTCACAAGAGAACCCACACCGGAGAGAAACCGTTCTCCTGCCAGCAGTGCGGCAAGAGTTTCTCTCAAAAGCAGAACCTGAAAGTGCACATGAGAGTTCACACCGGAGAGAAGCCCTTCAGCTGCCCGTTCTGCGGCCAGAACTTCACGCACAAAGGAAACCTCAAAACCCACGTGAGGAATCACACCGGCGAGAGCGCCTTCATCTGCAACCTCTGTGGCAAGAGCTTCTCCCGGAAGGAGAGTCTGAACACTCACATGAGGATTCACTCCGGAGAGAAGCCGTTCGGCTGTGCTCAGTGCGGAAAGTCGTTCAGATGCAAGGTAAATCTGAATTGCCACATGAGGATCCACTCGCGGGAGAGCAGCTTCATCTGTCATCACTGTGAACAGAGTTTCGGCGACAGCGATGAACTCAGGAGTCACGTGAACACTCATGTCGGAGAGAAGCC
Associated Phenotype:
Not determined