Busch Lab

ZMP

adck5

Ensembl ID:
ENSDARG00000075405
ZFIN ID:
ZDB-GENE-081104-149
Description:
Novel protein similar to vertebrate aarF domain containing kinase 5 (ADCK5) [Source:UniProtKB/TrEMBL
Human Orthologue:
ADCK5
Human Description:
aarF domain containing kinase 5 [Source:HGNC Symbol;Acc:21738]
Mouse Orthologue:
Adck5
Mouse Description:
aarF domain containing kinase 5 Gene [Source:MGI Symbol;Acc:MGI:2679274]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12134 Essential Splice Site Available for shipment Available now
sa23475 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4794
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114581 Essential Splice Site 8 579 None 16
ENSDART00000145380 Essential Splice Site 34 531 None 13
Genomic Location (Zv9):
Chromosome 19 (position 12478778)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11937124
GRCz11 19 11855466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGACAGCCCGAGCAGACGYGATACATGGCGGCAGAGACTTTCAGATCGG[T/C]AAGGGCATCATTGTTTATTAGTCGCTCACTTTTGCTCTTGCTCTTATGCC
Long Flanking Sequence:
ATGAAAACTTTGAAGCTCAGTATCTCAAAATCATTCAAAACGCAGATAGAACCTTATAATTACAAAGGGGACAATATGGGTTTTGTTTTATTTTTAGTTTTGTAATTCTGTCTTGAATATTTTAAATATGAACGCTCCCTTTAATTAAAGGCACTCATTAGCATTTTATGTAAACATTTTTTGTTTATTTATTTTGGGGTATCTACATATTATTGTTTAGGACTTTATTGAATTTTACTGCTTATATTTTGTACAAAAAACAATAACATTCGCTAACGTTAGATATGTTGTCAAAGGTGGAGTACAAGATCTGCAGGTCGCGTCAGACCACTGTCACGTGACTAGCAGATTCTCCAGGCTGTCCAATCAGAGTTCGCGCGTGCGTGATCTTGAAGCGCGAGGAAGTGTCCGAAACAAGGCAAGAAAGACCGCAGCGAGTCACTCATGCCATCGACAGCCCGAGCAGACGCGATACATGGCGGCAGAGACTTTCAGATCGG[T/C]AAGGGCATCATTGTTTATTAGTCGCTCACTTTTGCTCTTGCTCTTATGCCTTTCAGTCGAGCAATACGTTGCCTGTGTGCACCTTCTGCTCCCTGATTTGTATGATAAGTTTTGAAAGGTCACTTTCCATTTCACAATGCATGAATTAGAAAATATAGACTGTAATTATGCAGTTAAGTGCTAAACCTGAATAGTAGCACTCAAGGCCAGAATGAATGTCAAAGCATTCCTTGTATTGTAAGTTACTGCTGTAAGTTAATCCAACTAAATCTGAGGTTTTTGTATCCAAGTCTTAGAATAGGATTAGAAAGTTTCAGGAAAGACAGACTACCAGTCTTCTGTCTTTCACTTGTTTACGTTCACTAATAAAACATTACCATGGAAGCAATGGTGTAAATAGCATGGGTACTACAGTTACTGCTCACTATGGGATCGTTCTCCTTTGCAGTGGACCCATTATGTCCTTTTTACTAGATGTAAATGAAGTCTCTGATGTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12134
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114581 Essential Splice Site 8 579 None 16
ENSDART00000145380 Essential Splice Site 34 531 None 13
Genomic Location (Zv9):
Chromosome 19 (position 12478778)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11937124
GRCz11 19 11855466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGACAGCCCGAGCAGACGYGATACATGGCGGCAGAGACTTTCAGATCGG[T/C]AAGGGCATCATTGTTTAYTAGTCGCTCACTTTTGCTCTTGCTCTTATGCC
Long Flanking Sequence:
ATGAAAACTTTGAAGCTCAGTATCTCAAAATCATTCAAAACGCAGATAGAACCTTATAATTACAAAGGGGACAATATGGGTTTTGTTTTATTTTTAGTTTTGTAATTCTGTCTTGAATATTTTAAATATGAACGCTCCCTTTAATTAAAGGCACTCATTAGCATTTTATGTAAACATTTTTTGTTTATTTATTTTGGGGTATCTACATATTATTGTTTAGGACTTTATTGAATTTTACTGCTTATATTTTGTACAAAAAACAATAACATTCGCTAACGTTAGATATGTTGTCAAAGGTGGAGTACAAGATCTGCAGGTCGCGTCAGACCACTGTCACGTGACTAGCAGATTCTCCAGGCTGTCCAATCAGAGTTCGCGCGTGCGTGATCTTGAAGCGCGAGGAAGTGTCCGAAACAAGGCAAGAAAGACCGCAGCGAGTCACTCATGCCATCGACAGCCCGAGCAGACGCGATACATGGCGGCAGAGACTTTCAGATCGG[T/C]AAGGGCATCATTGTTTATTAGTCGCTCACTTTTGCTCTTGCTCTTATGCCTTTCAGTCGAGCAATACGTTGCCTGTGTGCACCTTCTGCTCCCTGATTTGTATGATAAGTTTTGAAAGGTCACTTTCCATTTCACAATGCATGAATTAGAAAATATAGACTGTAATTATGCAGTTAAGTGCTAAACCTGAATAGTAGCACTCAAGGCCAGAATGAATGTCAAAGCATTCCTTGTATTGTAAGTTACTGCTGTAAGTTAATCCAACTAAATCTGAGGTTTTTGTATCCAAGTCTTAGAATAGGATTAGAAAGTTTCAGGAAAGACAGACTACCAGTCTTCTGTCTTTCACTTGTTTACGTTCACTAATAAAACATTACCATGGAAGCAATGGTGTAAATAGCATGGGTACTACAGTTACTGCTCACTATGGGATCGTTCTCCTTTGCAGTGGACCCATTATGTCCTTTTTACTAGATGTAAATGAAGTCTCTGATGTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23475
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114581 Nonsense 142 579 5 16
ENSDART00000145380 Nonsense 168 531 5 13
Genomic Location (Zv9):
Chromosome 19 (position 12495965)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11954311
GRCz11 19 11872653
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGTCATCAGAGAGCCGCCAGCAATATGGTGGACGGAGCCATACAGAAC[G/T]GAGGCTTGTACATTAAGCTGGGACAGGGCCTGTGTGCATTCAACCATCTT
Long Flanking Sequence:
AGACGTTAAAGCAAGGTCCTGACTCTGTGATCATAAAAAAATCCCAAAATGTCCTATGAAAAAGAGTAAGGGTTTAACCCTGACATCCTGGCCAAATTTGCCCACTGGCCTCTGTCCATCAATGAACTGGTGTGAGATCTGGTGCGATATGGCTGCGGTCGCATTATCCAGGTGGATGCTTCACACAGGTGTTGGATGAGGAGATTCACCCCAAAAATGTGTAAAGCCTTTTGAGTGTCCAGAAAAGCGCTATATGTATGTAAGGAATTGTTAATTTTTAAACGGCATGAGTAATTAAAAACTAAAATAGTTTTTGTCAGTTGACTACAGTACATATGGATTCTTGTGGTTGCAGCACATAAATTATTCATTTGTTTTTGTATGTGATTCTTATGCGATCTGAACTCTTTCTTTGGCAGAGCAGTCCAGAGTTTCTGAAGCAGATGTCAGCGTGTCATCAGAGAGCCGCCAGCAATATGGTGGACGGAGCCATACAGAAC[G/T]GAGGCTTGTACATTAAGCTGGGACAGGGCCTGTGTGCATTCAACCATCTTCTACCTCCAGAATACATCCAAACCCTACATGTGCTTGAAGACAAAGCTCTCAACAGAAGATACAAAGAGGTGAGGGTTCTCGCAAAACATGCAAGGCGCATTACGGGTCAGATGTTTATTGGATGTTTTATAGGTGTGATAAATTCCTTCGTCAGAGATGAAACCTTTTATCAACGCTTACATTTTAAACAAGTGGCAAAAGGAATGGGATGCATTAGAAAACAATAAACTACATGAAATCCAACCTGAAGTTTCACAAAGAATTTTAAGACATTTTAAGAATCGATTTGATCAAGTAGTTTTTACCAGATGTCGTATTGGGCATACGAGGATTACACATGGTTTTTTGCTCCAAGGTGAAAACCCTACTCAGTGTTTGTGCTGCAAAACTCCTCTTACTGTAAAACATATTTTACTGGACTGTCCTGCTTGTACTGATTCCAGAAGGAC
Associated Phenotype:
Not determined