Busch Lab

ZMP

si:dkeyp-115d2.5

Ensembl ID:
ENSDARG00000075393
ZFIN ID:
ZDB-GENE-090312-170
Description:
Novel protein similar to H.sapiens SPOCK2, sparc/osteonectin, cwcv and kazal-like domains proteoglyc
Human Orthologue:
SPOCK2
Human Description:
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 [Source:HGNC Symbol;Acc:135
Mouse Orthologue:
Spock2
Mouse Description:
sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2 Gene [Source:MGI Symbol;Acc:MGI:189135

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22325 Essential Splice Site Available for shipment Available now
sa45488 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22325
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110061 Essential Splice Site 64 419 None 10
ENSDART00000132027 Essential Splice Site 67 364 None 11
ENSDART00000143581 Essential Splice Site 64 78 None 2
Genomic Location (Zv9):
Chromosome 13 (position 30306936)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29952884
GRCz11 13 30083334
KASP Assay ID:
2260-6539.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATTCTTTGCAGCTCATTTGACTGTTTGACTTCTTTTTCATTTCTGTC[A/T]GGATGATTACATCAGATCATGGGATGAAAATCAAGGCTCAAATGAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45488
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110061 None 278 419 7 10
ENSDART00000132027 Nonsense 282 364 8 11
ENSDART00000143581 None None 78 None 2
Genomic Location (Zv9):
Chromosome 13 (position 30342245)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29988193
GRCz11 13 30118643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAAGCTGAACTGGCTGCCATTAATCTGGACAAGTATGAAGTGTGTATA[C/A]GGCCCTTCTTCAACTCCTGTGACTCTTACCGCGATGGCAAAGTGTCCACA
Associated Phenotype:
Not determined