Busch Lab

ZMP

si:ch73-210n19.1

Ensembl ID:
ENSDARG00000075340
ZFIN ID:
ZDB-GENE-081104-257
Description:
Novel protein similar to H.sapiens MED1, mediator complex subunit 1 (MED1) [Source:UniProtKB/TrEMBL;
Human Orthologue:
MED1
Human Description:
mediator complex subunit 1 [Source:HGNC Symbol;Acc:9234]
Mouse Orthologue:
Med1
Mouse Description:
mediator complex subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1100846]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41990 Nonsense Mutation detected in F1 DNA Not yet available
sa45456 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15854 Essential Splice Site, Missense Available for shipment Available now
sa31866 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41990
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111372 None None 1377 None 15
ENSDART00000123701 None None 1366 None 17
ENSDART00000145656 Nonsense 305 318 6 6
Genomic Location (Zv9):
Chromosome 12 (position 16155163)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15266128
GRCz11 12 15308435
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACATGGGACGTACTGGTCAAGGAAGCTCGTGCATTGATACCATGGGA[C/T]AGGTTGGAGGTCAGCAGCAAGCAATGCAGCAGCAACATCAACAATCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45456
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111372 None 392 1377 9 15
ENSDART00000123701 Essential Splice Site 397 1366 10 17
ENSDART00000145656 None 315 318 6 6
Genomic Location (Zv9):
Chromosome 12 (position 16155195)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15266160
GRCz11 12 15308467
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCATTGATACCATGGGACAGGTTGGAGGTCAGCAGCAAGCAATGCAGCA[G/A]CAACATCAACAATCTCAGAGCCATGGGTCAGATGACTTTAACAAAGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15854
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111372 Missense 581 1377 12 15
ENSDART00000123701 Essential Splice Site 584 1366 None 17
ENSDART00000145656 None None 318 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16155950)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15266915
GRCz11 12 15309222
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTGATATTAATGAYATTCTTTCTGATAYTCCTGATCAAGCCAACAAAG[G/A]AAGCAATATCGGTCATGGACAGCATCTTATGAYTAGTGAAGATGGAGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7693
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111372 Essential Splice Site 698 1377 13 15
ENSDART00000123701 Essential Splice Site 694 1366 15 17
ENSDART00000145656 None None 318 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16156377)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15267342
GRCz11 12 15309649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCAGAATCCTGCCTCACATGGCCAAAAYACTCCTGAGACTTCATTAAA[A/T]GACCCTTTTGAAATTGGWATTTTTGGTGGAAACGGTGGRGGAGGAAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31866
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111372 Nonsense 1167 1377 14 15
ENSDART00000123701 Nonsense 1156 1366 16 17
ENSDART00000145656 None None 318 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16157830)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15268795
GRCz11 12 15311102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACATCCTCAAAGCATTCTATGTCCTCCCAAGGAGGTGAGTTTTTGAGC[A/T]AACGAGACAAGATAGACAAAGATGGGAAATCCAAGATGTCTGGATCAGGG
Associated Phenotype:
Not determined