Busch Lab

ZMP

si:dkey-29n19.1

Ensembl ID:
ENSDARG00000075328
ZFIN ID:
ZDB-GENE-091113-11
Human Orthologue:
ARHGAP21
Human Description:
Rho GTPase activating protein 21 [Source:HGNC Symbol;Acc:23725]
Mouse Orthologue:
Arhgap21
Mouse Description:
Rho GTPase activating protein 21 Gene [Source:MGI Symbol;Acc:MGI:1918685]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32476 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32476
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109650 Nonsense 75 1953 2 28
ENSDART00000133291 None None 708 None 17
Genomic Location (Zv9):
Chromosome 24 (position 6704041)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6544111
GRCz11 24 6573440
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCGCACCTCTCACGGCTTCGGCTTCACGCTCCGTCACTTCATCGTTTA[T/A]CCACCTGAGTCAGCCGTGCAGTCCTCTCTCAAGGTCAGTACACAGCAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30038
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109650 Essential Splice Site 110 1953 5 28
ENSDART00000133291 None None 708 None 17
Genomic Location (Zv9):
Chromosome 24 (position 6696161)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6536231
GRCz11 24 6565560
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAAAACATGGCATTGGTTAGGTGTTGAAAAAGTTGAAGCCCCTGCAAG[G/A]TCTGTCCAAATGTGTATAGTATGATTGCAGTAACTCCTCCGTGATATTTT
Associated Phenotype:
Not determined