Busch Lab

ZMP

LOC572450

Ensembl ID:
ENSDARG00000075321
Human Orthologue:
EPHA10
Human Description:
EPH receptor A10 [Source:HGNC Symbol;Acc:19987]
Mouse Orthologue:
Epha10
Mouse Description:
Eph receptor A10 Gene [Source:MGI Symbol;Acc:MGI:3586824]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43352 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36923 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43352
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111108 Essential Splice Site 27 272 1 3
ENSDART00000111108 Essential Splice Site 27 272 1 3
Genomic Location (Zv9):
Chromosome 19 (position 49644809)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48254467
GRCz11 19 47639761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTGGATATTATTGTTCAACAGAACCCCGGAGTCCCGTGCAGAGGAAGG[T/C]ACGTTCACGGCTTACAATTATTTGGACGGCAGGTGAATTGACGAGAAGAA
Long Flanking Sequence:
TAGACATCTCAATGAGATCTGCTCTCACACACCAGCCTCCAGAGCTCATTTGGCTCTTTTATTCAATAAAAAAGAATAATTGTGCCTAATCAGCAGCGCTTATAATGTGGGCCGAAACGATAACTAAATTTCATCATTTCCAACACCGCCTCCATTCAGGGGGGAGAAAATCTGTGCGGTGGAATTTTATCAGACCCCATCTGATTGGCTCTCCGCTAATCTCCGCATACTCTTATTCTATTGGTCGCCGCACCTGTCAGTCAGAGGGTCAGTGCCCGCCCACCCGCTGCTCTAATAAGGCTGATAGTAGCGCTGTGTGTGTGTCAGAATCCCGGACTGACGCTCCGCGTTTCCCGCTCAGTGAGTCCCGCGCGCTCGGTTGCGACATGACCAGAGTCCCGCACTCCTGCCCCGCCAAACATGGAGCACTTTAAATCCTTCATTTCGCTGCTCTGGATATTATTGTTCAACAGAACCCCGGAGTCCCGTGCAGAGGAAGG[T/C]ACGTTCACGGCTTACAATTATTTGGACGGCAGGTGAATTGACGAGAAGAAGTGATACTGTAACTCGCTGCAGCTGTGTGTGTGCGCGTGTGTGTGAGCGCGTGTGTTCAAATTCCGCCGCTGTCGTGTCAAGTAAAGTTATCCTATATTAATTGACGGTATTAATTCATAAGGAGATCTGATCTAAACTGACATCACGCTCTGAGGGATTTTAAAAACACTTCAAAGAGACCGCTGCCGGTGAAGTGCAACAATGTATCGTTTAAAACATTCTAATGTTCGAAAATTAACGGCTGGAAATTGTTACATTGTTTCTGACAGTATGCTTTGAATTTGTGCCTGAAACTCAATTACATTACTGTAAATGACAGTTGTGTTGATTTAAAATAGATGTATTCATGTATATTAATTTATTAAAATGTATGTAAAAATTTATTAACATATGCTGATTAAAGTTATAATATATATAAAATATTTTTTATTTATCTAATACATTAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36923
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111108 Essential Splice Site 27 272 1 3
ENSDART00000111108 Essential Splice Site 27 272 1 3
Genomic Location (Zv9):
Chromosome 19 (position 49644809)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48254467
GRCz11 19 47639761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTGGATATTATTGTTCAACAGAACCCCGGAGTCCCGTGCAGAGGAAGG[T/C]ACGTTCACGGCTTACAATTATTTGGACGGCAGGTGAATTGACGAGAAGAA
Long Flanking Sequence:
TAGACATCTCAATGAGATCTGCTCTCACACACCAGCCTCCAGAGCTCATTTGGCTCTTTTATTCAATAAAAAAGAATAATTGTGCCTAATCAGCAGCGCTTATAATGTGGGCCGAAACGATAACTAAATTTCATCATTTCCAACACCGCCTCCATTCAGGGGGGAGAAAATCTGTGCGGTGGAATTTTATCAGACCCCATCTGATTGGCTCTCCGCTAATCTCCGCATACTCTTATTCTATTGGTCGCCGCACCTGTCAGTCAGAGGGTCAGTGCCCGCCCACCCGCTGCTCTAATAAGGCTGATAGTAGCGCTGTGTGTGTGTCAGAATCCCGGACTGACGCTCCGCGTTTCCCGCTCAGTGAGTCCCGCGCGCTCGGTTGCGACATGACCAGAGTCCCGCACTCCTGCCCCGCCAAACATGGAGCACTTTAAATCCTTCATTTCGCTGCTCTGGATATTATTGTTCAACAGAACCCCGGAGTCCCGTGCAGAGGAAGG[T/A]ACGTTCACGGCTTACAATTATTTGGACGGCAGGTGAATTGACGAGAAGAAGTGATACTGTAACTCGCTGCAGCTGTGTGTGTGCGCGTGTGTGTGAGCGCGTGTGTTCAAATTCCGCCGCTGTCGTGTCAAGTAAAGTTATCCTATATTAATTGACGGTATTAATTCATAAGGAGATCTGATCTAAACTGACATCACGCTCTGAGGGATTTTAAAAACACTTCAAAGAGACCGCTGCCGGTGAAGTGCAACAATGTATCGTTTAAAACATTCTAATGTTCGAAAATTAACGGCTGGAAATTGTTACATTGTTTCTGACAGTATGCTTTGAATTTGTGCCTGAAACTCAATTACATTACTGTAAATGACAGTTGTGTTGATTTAAAATAGATGTATTCATGTATATTAATTTATTAAAATGTATGTAAAAATTTATTAACATATGCTGATTAAAGTTATAATATATATAAAATATTTTTTATTTATCTAATACATTAGATA
Associated Phenotype:
Not determined