Busch Lab

ZMP

MYO15A (1 of 3)

Ensembl ID:
ENSDARG00000075292
Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Human Orthologue:
MYO15A
Human Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Mouse Orthologue:
Myo15
Mouse Description:
myosin XV Gene [Source:MGI Symbol;Acc:MGI:1261811]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa13847 Essential Splice Site Available for shipment Available now
sa11241 Essential Splice Site Available for shipment Available now
sa6043 Nonsense Mutation detected in F1 DNA Not yet available
sa40134 Nonsense Mutation detected in F1 DNA Not yet available
sa40133 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6909 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44570 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20095 Essential Splice Site Available for shipment Available now
sa15876 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13847
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 24 1558 2 41
Genomic Location (Zv9):
Chromosome 3 (position 40101666)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39965026
GRCz11 3 40106884
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTTTCAATCCAACATTAAAAAGTTTTGACCTGCTTTTTCTTCCGTTTT[A/G]GCTGAGATATGAGGCCAGGAGAAAGGCAGAAGAGGAGCAGAGGAGAAWAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11241
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 41 1558 2 41
Genomic Location (Zv9):
Chromosome 3 (position 40101609)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39964969
GRCz11 3 40106827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATGAGGCCAGGAGAAAGGCAGAAGAGGAGCAGAGGAGAATAGAAATGG[T/A]ATTTGTTTTCCAAATGAACCACATTGGAATACKTTTATGCTTTCCGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6043
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Nonsense 71 1558 4 41
Genomic Location (Zv9):
Chromosome 3 (position 40100580)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39963940
GRCz11 3 40105798
KASP Assay ID:
554-3956.1 (used for ordering genotyping assays)
KASP Sequence:
TATAGAGTGTAATTCNNNNNNNCTTATTCTTTCACTCTCATCTGTGTTTTAGGTGGT[C/T]GAGAGCTCCATTCTGATTGTTTGGCTTTGGTCCAGGCTCCCACAGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40134
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Nonsense 258 1558 7 41
Genomic Location (Zv9):
Chromosome 3 (position 40098022)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39961382
GRCz11 3 40103240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCAAGCCATGCAGAAGTCCCTGTATGGACCAGAGACAGCGAGGACTTA[C/A]CCATTGTCTCTGCTGGAATGGACAGCCAATAGGAAGAAAGCAAACATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40133
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 407 1558 10 41
Genomic Location (Zv9):
Chromosome 3 (position 40088729)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39952089
GRCz11 3 40093947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCATGCTCAGCTCCAGCCTCCCAGATTCAGATGGATATTACAGCCATGG[T/G]CTGCTATTGTTTTAGTTTTTACATTTTTATTTGTAATAAAAAAACTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6909
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 750 1558 20 41
Genomic Location (Zv9):
Chromosome 3 (position 40076100)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39939460
GRCz11 3 40081318
KASP Assay ID:
554-4949.1 (used for ordering genotyping assays)
KASP Sequence:
CAAAAGACAGCTTCAACCACCCACTGATACTAGACCTACTGTTTAAGCAG[G/A]TTAGTTTTGGTTTTGATTCATTTTTAGCAYCATTCCTCCAGTCTTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44570
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 1129 1558 30 41
Genomic Location (Zv9):
Chromosome 3 (position 40064623)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39927983
GRCz11 3 40069841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTATGAAAGGCCAAGCTGAGCAGGACGTCATCAGCACCATCCTAAGG[G/A]TATGCACCTCTTCAAATATTCCAATATGCCTTCCCATCATGAAATATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20095
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 1233 1558 34 41
Genomic Location (Zv9):
Chromosome 3 (position 40060536)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39923896
GRCz11 3 40065754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCACATTTCACCAATCTGTACATAATCATGCATAATGTGTTGTTTTTC[A/G]GGCTGGAAGGAGCTCCAAACGGCAGTTGTTTCTTCTTCCTGGTGGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15876
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Nonsense 1473 1558 39 41
Genomic Location (Zv9):
Chromosome 3 (position 40056697)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39920057
GRCz11 3 40061915
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCGACACCCCCTGTGTACTGGCTGTCAATCAAAACGGTYTGAACTTTT[T/A]GAGCAAAGAGACTCATGTAAGTGTAATCACATTGGCTTYTRGATAAAATA
Associated Phenotype:
Not determined