Busch Lab

ZMP

si:dkeyp-73b1.2

Ensembl ID:
ENSDARG00000075284
ZFIN ID:
ZDB-GENE-081104-473
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A9C3V7]
Human Orthologue:
C2orf67
Human Description:
chromosome 2 open reading frame 67 [Source:HGNC Symbol;Acc:26310]
Mouse Orthologue:
1110028C15Rik
Mouse Description:
RIKEN cDNA 1110028C15 gene Gene [Source:MGI Symbol;Acc:MGI:1915941]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa34713 Nonsense Mutation detected in F1 DNA Not yet available
sa27451 Nonsense Mutation detected in F1 DNA Not yet available
sa45368 Nonsense Mutation detected in F1 DNA Not yet available
sa44708 Nonsense Mutation detected in F1 DNA Not yet available
sa41492 Nonsense Mutation detected in F1 DNA Not yet available
sa7204 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13455 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34713
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108893 Nonsense 40 821 1 15
ENSDART00000147652 None None 615 None 15
ENSDART00000148262 None None 206 None 4
Genomic Location (Zv9):
Chromosome 9 (position 39789711)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38927607
GRCz11 9 38737402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCTTTGTTTCAGGACTCGCATCCCAAAGGTTTTCTGCTGTCAAGCCCA[G/T]AACCACTGCTCAGCCTCCTCTCTTTAAACAAGAACTCACCGGGTTCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27451
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108893 Nonsense 231 821 1 15
ENSDART00000147652 Nonsense 18 615 1 15
ENSDART00000148262 Nonsense 122 206 1 4
Genomic Location (Zv9):
Chromosome 9 (position 39790284)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38928180
GRCz11 9 38737975
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAACTTAGAGATGTGCAGAATGTAGCTCACAGTGGTCATGCTGTTCTG[C/T]AAGGACTGCTGGAGTCTCTGGACTCAGATGCCACAGCTAGCAGCTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45368
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108893 Nonsense 271 821 2 15
ENSDART00000147652 Nonsense 58 615 2 15
ENSDART00000148262 Nonsense 162 206 2 4
Genomic Location (Zv9):
Chromosome 9 (position 39796170)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38934066
GRCz11 9 38743861
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTTTTCTTTCTTTCTGGGAGGGTAGTTGTGATGTTTGTGAGGTGAGAT[G/A]GCTGAAGGACAGAGCTGAACTCTGCAGTCGCTGGACATGGATGCAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44708
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108893 Nonsense 414 821 5 15
ENSDART00000147652 Nonsense 201 615 5 15
ENSDART00000148262 None None 206 None 4
Genomic Location (Zv9):
Chromosome 9 (position 39800480)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38938376
GRCz11 9 38748171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGTCAAGCGACATTCACTTGTGTCTCTTGTTCCCAGTGGATCACAGTG[T/A]TTACCTAAAGCCAAGAAGAGGAAGCGAATATGTCAAAGACGACTTTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41492
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108893 Nonsense 453 821 5 15
ENSDART00000147652 Nonsense 240 615 5 15
ENSDART00000148262 None None 206 None 4
Genomic Location (Zv9):
Chromosome 9 (position 39800595)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38938491
GRCz11 9 38748286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCTTTATGTCAGCCCGGACTCGACCCCTTCTGAACCATCACAAGCGT[A/T]GACTTTTCCTCATGGACCCATTGTCTCATAGAGAACAGGTTGGTATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7204
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108893 Essential Splice Site 557 821 7 15
ENSDART00000147652 Essential Splice Site 344 615 7 15
ENSDART00000148262 None None 206 None 4
Genomic Location (Zv9):
Chromosome 9 (position 39805970)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38943866
GRCz11 9 38753661
KASP Assay ID:
554-4485.1 (used for ordering genotyping assays)
KASP Sequence:
CCTCATCACTGTCTMAGGTCTAGAGGCAGAGYCTCCCGATCATTATTCCG[T/C]AAGAGAAATCTTTTCATTTTTATGTGAATGCATTTACAGTAGGTACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13455
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108893 Nonsense 616 821 9 15
ENSDART00000147652 Nonsense 403 615 9 15
ENSDART00000148262 None None 206 None 4
Genomic Location (Zv9):
Chromosome 9 (position 39815065)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38952961
GRCz11 9 38762756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTGCTTTGTTGCAGGCATRCAGGTCTCCAGGGTTACACCGCAGCCYTA[T/A]CTGRTGTCCAAGAGTGATGACAGTCATGTAGAGGAAYCTTCAGAGGATGT
Associated Phenotype:
Not determined