Busch Lab

ZMP

LOC100331644

Ensembl ID:
ENSDARG00000075281
Human Orthologue:
TBC1D30
Human Description:
TBC1 domain family, member 30 [Source:HGNC Symbol;Acc:29164]
Mouse Orthologue:
Tbc1d30
Mouse Description:
TBC1 domain family, member 30 Gene [Source:MGI Symbol;Acc:MGI:1921944]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26204
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130588 Nonsense 619 1041 13 14
Genomic Location (Zv9):
Chromosome 4 (position 4360898)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4479274
GRCz11 4 4488187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGCGCAGGACGAGCCGAACACCAGGCTGCCATCAACAGCATGATGCTG[G/T]AGCGCATGAGCACTGACATCAGCGCCCTGAAGAAACAGTACTCGCGTATT
Long Flanking Sequence:
AAAACATATGCAGATTATGTCTGGTCCTGGTTATAATCTTCAGTTTCAGTACACATGAATAAATGGAAGATTTGGAGATGATCCGACACAAAACACCTCCGATGAAAATCAGTGTAATAATACTGGACACTTTTACTGGGGAATTAAGTTTTTAGTTACTACACTCTTAAAATCATTCTGCATAAATCCAGAGATTTTGTACAAAATTCTGTACAGAAATAACCCAAATAATATCAGCAGATTCTGCAAGGTCTTGGTTGAAATCTTCAATTTCAGTGCAAATGAATAAATGGAAGATTTAGAAATGATCTGATGCAAATTCCCCAGTTAAAGTGTCCATTAGTCTTACACTGATTTTCATCTGGAGGTTTTTTTTTTTTGGATGTGCAGATCAGAGAGCGGAGCAGAGCTGTAATGGCAGTAATATGGCAGAGCTCAGTCCCGGGGCGGTTGGCGCAGGACGAGCCGAACACCAGGCTGCCATCAACAGCATGATGCTG[G/T]AGCGCATGAGCACTGACATCAGCGCCCTGAAGAAACAGTACTCGCGTATTAAACAGAAACAACAGCAGCAGGCCGGACTGCTCTACATTCACACAGGTACAAACGTCATGCTGATATAACGAGCTTAAAGTCTGATTGATGTAATAAAAATAACTATTGGAGATGCACTGGTTTACAAAGAAGTTCATTTGACTTGATTTTTTTATATTTAAAAATAGTTGTAAAAAATCTAATGAAGAAAATAATTAATGAACAATATATAAAAGTAAATAAATGCATGTTTTTAATACATTTGCATTGTGTATTTTGCTATATATCTTTATACATAGCAATACATCTTTAACATGTTAGTTTTATTATACAGTATTTAATAGCTTTTTTTTTGGGGGGGGGGTTGTGGCTGGAAGGGCACCCGCTTCGTAAAAACGTGCTGGATAAGTTGGCAGTTCATTACGCTGTGGCGACCCCGAATTAATAAAGGGACTAAGCCGACAAGAAAA
Associated Phenotype:
Not determined