Busch Lab

ZMP

CDH22

Ensembl ID:
ENSDARG00000075268
Description:
cadherin 22, type 2 [Source:HGNC Symbol;Acc:13251]
Human Orthologue:
CDH22
Human Description:
cadherin 22, type 2 [Source:HGNC Symbol;Acc:13251]
Mouse Orthologue:
Cdh22
Mouse Description:
cadherin 22 Gene [Source:MGI Symbol;Acc:MGI:1341843]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20832 Nonsense Available for shipment Available now
sa18858 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8252
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110855 Nonsense 75 519 1 8
Genomic Location (Zv9):
Chromosome 6 (position 56826951)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 56880103
GRCz11 6 56877144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAGTTCTTCGTTGTGGAGGAATACACCGGGACGGAGCCACTTTATGTG[G/T]GAAAGGTAGGACTGCATTTTGTGGCATACAGTTAAAGTCAGAATTTTCAG
Long Flanking Sequence:
GAGGAGAGTTATAGCTGTGTATCACCGAAACGGCCTCATCTTTCCAAGAAAGATTCTTCTTAAATGCCCTCTTGAGGACCCAGTGGCCTCTTCCGTTCTAAAAAAAAAAAATGACCAAAAAGCTATTGGATTTATAGTTTCATTGAGCAGCAGTGAACTCTCGTTTACCTTCCTCAACCCCAGAGTCAAGGAGCTTTTCTGAAGCAATCAGGAGGAAAACTTCACCCTGAACGAGTTTCTAACTTCTGCTCCATGTAGAGACCAGAGAGATTTTAAACATGGCTCCCTGCTGGAGAGGAGGAGCTCAGGTTTTGGCGGTGACTTTGGGAATTTTGCATTGCTGCGGATGGCTGTCGGGTCAGACCGTAAGGACTAGTGTTGGGAAAACAAGAGAAGCTTCTGAGCAGTGGTCGATGCTGCATGAACGGGTTAAAAGGGGATGGGTTTGGAATCAGTTCTTCGTTGTGGAGGAATACACCGGGACGGAGCCACTTTATGTG[G/T]GAAAGGTAGGACTGCATTTTGTGGCATACAGTTAAAGTCAGAATTTTCAGCCCCTCTCTGTATTCGTTCTCCAATTTCTGTTTAATGGAGAGAAGATTGTTTTCAATACATTTCTAAACATAATAGTTTTAATAACTCATTTCTAATGACTGATTTATTTTATCTTTGCCATGATTATGGTACATAATATTTGACTAGATATTTTTTATGATAGTAGTATTAAGCTAAAAGTGACATTTAAAGGCTTGACTAGGTTATTAATTAAGGTAAAGTTATGGTAGTTAAGTAAGTCATTGTATAACAGTGGTTTGTTGTGTAGACAATCGCAAAAAAAAATATAGCTTAAGGAGTTAATGATATTGACCTCAAAATGGAGTTTAAAAAAGGGTGAGGCAGTGGCGCAGTAGGTAGTGCTGTCGCCTCACAACAAGAAGGTCACTGGTTCGAACCTGGGCTCAGTTGGCGTTTCTGTGTGGAGTTTGCATGTTCTCCCTGCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20832
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110855 Nonsense 314 519 5 8
Genomic Location (Zv9):
Chromosome 6 (position 56731739)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 56784891
GRCz11 6 56781932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTGAGAATACGGATATGAGTTACCTGATCAAAGACGAGGAGGGAGGA[G/T]AGCTGTTCAGAGTGTCCACTGATGGAGACACACAGGAGGCCGTCATCGCC
Long Flanking Sequence:
CTGCCTAGTTAACCTAATTACCCTAGCCTTTAAGCCTTTAAATGTCACTTTAGGCTGTATAGAAGTGTCTTGAAAAATATCTAGTCTAATATTATTTACTGTCATCATGGCAAAAATAAAATAAATCAGGAATTAGAGGTGAGAAATTAAAACTATTATATTTAGAAATGTGCTGAAATAACTTCCCTACATTAAACAGAAATTGGAGGAAAAAATAAACAGGGGGCGCATAATTCTGACTTCATGTATGTATTATACAAACATAACACAGATTGCTATATTCCCCAGGGCTAATATGCATATATTCTCAGGCCAGCGTGTGAACATGAATGGAGCTGATCTGAAAGTATCATCTTCTCTTTTCTGTCACAGAGATGTATCAGTTTTCGGTCTCGGAGGGCGCCGCCGTCGGGACAGCGATCGGTCGGGTGATCGCGACAGATGCAGACATGGGTGAGAATACGGATATGAGTTACCTGATCAAAGACGAGGAGGGAGGA[G/T]AGCTGTTCAGAGTGTCCACTGATGGAGACACACAGGAGGCCGTCATCGCCATCAGAAAGGTACAGGAGACCTTCAGACCTGTCGTTTTACACTCTGAAGGTCATGCGCTTGTTTATAGCATTAAGTACTGATCAAAAAGCACCAGAACTGATTACCAAACTAAAATATGTAAACACTTTAGCTGTAAAAATGCGTAAAAAGCACATTAAAATATATTTTTTTATAATCCTAAAACATGTTTACAAATTATTTTATTATGCATTCATTTGTTCGTTCAGTTTGTTTGTTTATCATTCATTTATTTATTCATTCATTCATTCATTCATTCATTCATTCTTTATTTATTTATTCATTTATTCTTTCATTCATTTATTTATTTATTTAGTAAGTTATAGTTTATTTAATTATTTTTATTTACTTATTTAATTATTTTTTGTCTATATATATTTTTTATTTGTCTATATATATATTTTTTTGTATTAAATATTTGTTTATTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18858
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110855 Essential Splice Site 419 519 6 8
Genomic Location (Zv9):
Chromosome 6 (position 56729490)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 56782642
GRCz11 6 56779683
KASP Assay ID:
2259-8250.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGAATCGTGACAGCCAGAGATCCAGATATGGACAACGTCCCCATCAG[G/A]TGTGGTTTAATACAGTTCAAGTTTATTTGTATAGACACACACTTGAAACA
Long Flanking Sequence:
TGTCTGACAAGTTATGTTATGCTTGCTTGATATGAATCAGTCAAGATTTCACACATGAAGCACTAGCTGGAGATGGACATTTGTACAGCAATACAAGCATTTTACTGTATTTTCATTAACTAACGTTAACAGATACTGTAATAAATGTAATGTTCATTGTTTGTTCAAGTTTGTAAATGCATTAATAAACAATAACTAATACAAGCTTTTTGTAAAGTTTTACTGATGTCCTTTTCTCTTCAGCCTCTAGACTTTGAGCACAAGCGCACACATAATGTGGTGGTGGAGGCTGTAAACAAGCACGTGGACCCTCGTTTTGTTGATCTGGGGTCTTTCCGGGACCAGACCATCGTGAGAGTCAGTGTTTCTGATGTGGACGAGCCGCCGATCTTCATGCCACCCGCTGGAACCATCATGGAGGTTCAGGAGGATGCTCGGCTAGGAGCGCTGGTGGGAATCGTGACAGCCAGAGATCCAGATATGGACAACGTCCCCATCAG[G/A]TGTGGTTTAATACAGTTCAAGTTTATTTGTATAGACACACACTTGAAACACACTTTACGTAATGTATATCAGATTTGCAAAAATGTCGACAGCGGCCTCTAGTGGATTTTACATCTGAAATGGGCAACAAAACATGCCCAGGGTCATGGGGGCCACTTGGGGGTGAACGTTAGGATGATTACAAGGCCTCATGCAGTTCATCAACCCCAAAACCCACAACACCTCCACCCAACAACTCCACCCACCCCCTCTTCACTTTCATTTGGGACACATTGACACCCCCCCCCCACCACTACCTTTTTGCTACTAAACCCCAGCTCTTTACTTTCGTCCGTGACATAAACATCACGACCTAAATCTAACCCTAATATCATCGTCTTATGACGTTGTGTGCCCGCTGGGCAATAACTACATGCACTACAGAATGTTACGTTTACACACATCCACAAACTACATGTAAATGCATCAGCTTTTACAGCGTAATACTCACTACTATTTTA
Associated Phenotype:
Not determined