Busch Lab

ZMP

si:dkeyp-74a11.1

Ensembl ID:
ENSDARG00000075264
ZFIN ID:
ZDB-GENE-081104-474
Description:
Novel protein similar to vertebrate family with sequence similarity 124A (FAM124A) [Source:UniProtKB
Human Orthologue:
FAM124A
Human Description:
family with sequence similarity 124A [Source:HGNC Symbol;Acc:26413]
Mouse Orthologue:
Fam124a
Mouse Description:
family with sequence similarity 124, member A Gene [Source:MGI Symbol;Acc:MGI:3645930]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41415 Nonsense Mutation detected in F1 DNA Not yet available
sa18419 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41415
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112058 Nonsense 185 559 3 4
ENSDART00000141377 Nonsense 162 272 4 4
Genomic Location (Zv9):
Chromosome 9 (position 24903447)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24059233
GRCz11 9 23870102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTGCATTATGGCAAAGAAATTGCACGTTTTACGGTCTACTGCCACTA[T/G]GAGACCTACACTGAGCAGGTGCGTCTCTATAGGCTGCTGCTACGCCGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18419
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112058 Nonsense 224 559 3 4
ENSDART00000141377 Nonsense 201 272 4 4
Genomic Location (Zv9):
Chromosome 9 (position 24903332)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24059118
GRCz11 9 23869987
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGGATTTCAGTTTCTGCGTGGTTTACTCTAACCCTGARACAGAAATA[C/T]AGCTGTCATTCAAGCGGATGCCCCGCGGCCAGAGTCCAGCTCCAACTGAA
Associated Phenotype:
Not determined