Busch Lab

ZMP

wdr11

Ensembl ID:
ENSDARG00000075245
ZFIN ID:
ZDB-GENE-081107-28
Description:
Novel protein similar to vertebrate bromodomain and WD repeat domain containing 2 (BRWD2) [Source:Un
Human Orthologue:
WDR11
Human Description:
WD repeat domain 11 [Source:HGNC Symbol;Acc:13831]
Mouse Orthologue:
Wdr11
Mouse Description:
WD repeat domain 11 Gene [Source:MGI Symbol;Acc:MGI:1920230]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15911 Nonsense Available for shipment Available now
sa35403 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15911
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114328 Nonsense 258 1239 6 29
ENSDART00000136977 None None 897 None 22
ENSDART00000147490 Nonsense 15 81 1 2
Genomic Location (Zv9):
Chromosome 13 (position 2541901)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2625337
GRCz11 13 2758515
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTKCAGGGCTGAAGCAGTGACTCTTAATGACTGCCTCCAGCTCTCATA[T/A]CTRCCATCTAAGAGAAACCACATGCTGCTGTTGTACCCAAGAGAGATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35403
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114328 Essential Splice Site 299 1239 6 29
ENSDART00000136977 None None 897 None 22
ENSDART00000147490 Essential Splice Site 56 81 1 2
Genomic Location (Zv9):
Chromosome 13 (position 2541776)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2625462
GRCz11 13 2758640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGTTGGTGTGGTGGCTATTGAGCGCTCCGGCGTGCCCTTCATACAGG[T/A]GCGTTTGAAGGGAATGCGGGCACATACAGCTGAAGTGTTGCCTCAAACTA
Associated Phenotype:
Not determined