Busch Lab

ZMP

si:dkey-228d14.7

Ensembl ID:
ENSDARG00000075230
ZFIN ID:
ZDB-GENE-090312-88
Description:
Novel protein similar to vertebrate tet oncogene family member 3 (TET3) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
TET1
Human Description:
tet oncogene 1 [Source:HGNC Symbol;Acc:29484]
Mouse Orthologue:
Tet1
Mouse Description:
tet oncogene 1 Gene [Source:MGI Symbol;Acc:MGI:1098693]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa42172 Nonsense Mutation detected in F1 DNA Not yet available
sa6292 Nonsense Mutation detected in F1 DNA Not yet available
sa11214 Nonsense Available for shipment Available now
sa22265 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42172
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109642 Nonsense 133 1855 1 10
ENSDART00000141009 None None 559 None 8
Genomic Location (Zv9):
Chromosome 13 (position 18252073)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18072108
GRCz11 13 18203100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTAAAATATCCAGACACACGACTAGTTCTTTGAACCAAAATGGCTTAT[T/A]GTTGGAATGTAATGGGAAGGGGAAGTCACCTAGAAAGAGTGTCTCATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6292
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109642 Nonsense 145 1855 1 10
ENSDART00000141009 None None 559 None 8
Genomic Location (Zv9):
Chromosome 13 (position 18252108)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18072143
GRCz11 13 18203135
KASP Assay ID:
554-5213.1 (used for ordering genotyping assays)
KASP Sequence:
ACCAAAATGGCTTATTGTTKGAATGTAATGGGAAGGGGAAGTCACCTAGA[A/T]AGAGTKTCTCATGTCCRAGCATCCAAAGGRATGTTCRGAAAAAGGGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11214
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109642 Nonsense 911 1855 2 10
ENSDART00000141009 None None 559 None 8
Genomic Location (Zv9):
Chromosome 13 (position 18324965)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18145000
GRCz11 13 18275992
KASP Assay ID:
2260-6241.1 (used for ordering genotyping assays)
KASP Sequence:
AGTCCACCAAATGGCATGGCTAMTCAGAGTTTGAAATACAATCAAAATTA[T/G]TTGGGGCAGCATTTGAAAAAGCAGAGGAAACCGAAGATGACACCATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22265
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109642 Essential Splice Site 1556 1855 10 10
ENSDART00000141009 None None 559 None 8
Genomic Location (Zv9):
Chromosome 13 (position 18343999)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18164034
GRCz11 13 18295026
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACATTCTCTATGGCACCTTTAAATATTATACATTTCTTCTGTTTGCA[G/T]GTTTTAAACAAACCTCTACTGAGAATTCCTCCTTTTCGGAAAAGAATTCG
Associated Phenotype:
Not determined