Busch Lab

ZMP

si:dkey-56e3.3

Ensembl ID:
ENSDARG00000075194
ZFIN ID:
ZDB-GENE-050411-91
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A4C5]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31220 Essential Splice Site Available for shipment Available now
sa39660 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1983
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111367 Nonsense 69 575 1 8
Genomic Location (Zv9):
Chromosome 1 (position 41978839)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40895155
GRCz11 1 41596319
KASP Assay ID:
554-2802.1 (used for ordering genotyping assays)
KASP Sequence:
AACTTGTTGAGGACAGCTATGCYGATTTACAGCTTGAAATATCTCAAACG[C/T]AAAAGGAAAATAGCCTGCTTAAAAAGAGATTGAAAATGATAGAAATCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31220
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111367 Essential Splice Site 149 575 2 8
Genomic Location (Zv9):
Chromosome 1 (position 41979242)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40895558
GRCz11 1 41596722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCTCTTCAAACTCCTCAGTTTTACAACAACAACAAAGGCTTGACCAGG[T/C]CTGCACAACCAACACCTGGAACTGATTATATACAGTCAGATTATTTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39660
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111367 Nonsense 178 575 3 8
Genomic Location (Zv9):
Chromosome 1 (position 41981795)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40898111
GRCz11 1 41599275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATGTTCTCATTATTAAAGAGGAGAGGCCTGAAAACACGAGGTGTGAA[C/T]AGTCTGAAAGAGAAAAACAGACCACCGAGAATCGTGAGTATGGGAGGTGT
Associated Phenotype:
Not determined