Busch Lab

ZMP

si:dkey-229j15.3

Ensembl ID:
ENSDARG00000075192
ZFIN ID:
ZDB-GENE-091113-41
Human Orthologue:
YME1L1
Human Description:
YME1-like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:12843]
Mouse Orthologue:
Yme1l1
Mouse Description:
YME1-like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1351651]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44169 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13524 Essential Splice Site Available for shipment Available now
sa12120 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44169
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110185 Essential Splice Site 55 729 2 18
ENSDART00000132417 Essential Splice Site 55 685 2 18
Genomic Location (Zv9):
Chromosome 24 (position 33731934)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32611861
GRCz11 24 32526504
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGTCTGCAGAAAGACCTTTCACCTGAACACGACCCACTTCACTATGAG[G/A]TAGGACAGTCACGGGAACGGCACGCACTACACTTCAGAGAGATGATAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13524
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110185 Essential Splice Site 117 729 3 18
ENSDART00000132417 Essential Splice Site 117 685 3 18
Genomic Location (Zv9):
Chromosome 24 (position 33736070)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32615997
GRCz11 24 32530640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAGAACATCTCACATTTCTGCCCCCTCCTTCTTCCAAAACAAATATGG[T/A]GAGCTTTGCCACAAYAMNGAGTGGTGATGTCATACTTTAGATAGACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12120
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110185 Nonsense 695 729 18 18
ENSDART00000132417 None None 685 18 18
Genomic Location (Zv9):
Chromosome 24 (position 33753182)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32633109
GRCz11 24 32547752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGCCTTTTAGAGTTCGTATGAAAGGGCAAAGAAGATCCTGAAGACCTA[C/A]AGYAAAGAACACAAGCTGCTGGCYGATGCCCTGCTGACTTACGARACGCT
Associated Phenotype:
Not determined