Busch Lab

ZMP

si:dkey-45m5.4

Ensembl ID:
ENSDARG00000075188
ZFIN ID:
ZDB-GENE-081104-414
Description:
A disintegrin and metalloproteinase with thrombospondin motifs 10 [Source:RefSeq peptide;Acc:NP_001
Human Orthologue:
ADAMTS10
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 10 [Source:HGNC Symbol;Acc:13201]
Mouse Orthologue:
Adamts10
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10 Gene

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa38685 Nonsense Mutation detected in F1 DNA Not yet available
sa34374 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9421 Nonsense Available for shipment Available now
sa18917 Nonsense Mutation detected in F1 DNA Not yet available
sa31645 Nonsense Available for shipment Available now
sa7130 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38685
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113910 Nonsense 87 1108 2 24
Genomic Location (Zv9):
Chromosome 8 (position 20909904)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20339801
GRCz11 8 20371886
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCGGCGCAGCACCGAAACACAGAGCGCTCCAGAGCCGCAGCTGTACTA[T/A]CAGCTCTCCACTTCCAGCACTGATCTGCTGCTCAACCTCACGCTGCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34374
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113910 Essential Splice Site 208 1108 3 24
Genomic Location (Zv9):
Chromosome 8 (position 20906930)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20336827
GRCz11 8 20368912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTCGTCTCTGAGATATCAGAACATGGACCAGTCCTGTGGAGTTATCGG[T/G]AAGAACCAAAAAGTTTGTAAGTTTTAAATGAAATTTGTTTGCCAACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9421
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113910 Nonsense 495 1108 10 24
ENSDART00000113910 Nonsense 495 1108 10 24
Genomic Location (Zv9):
Chromosome 8 (position 20886702)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20316599
GRCz11 8 20348684
KASP Assay ID:
2260-0458.1 (used for ordering genotyping assays)
KASP Sequence:
GATGCAGACGAGCAGTGCCGCTTCCAGTACGGAGTGAAGTCTCRTCAGTG[T/A]AAATACGGGGTACTTGCATCACTACGTGTAACAACARCTCTTTTTTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18917
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113910 Nonsense 495 1108 10 24
ENSDART00000113910 Nonsense 495 1108 10 24
Genomic Location (Zv9):
Chromosome 8 (position 20886702)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20316599
GRCz11 8 20348684
KASP Assay ID:
2260-0458.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGCAGACGAGCAGTGCCGCTTCCAGTACGGAGTGAAGTCTCGTCAGTG[T/A]AAATACGGGGTACTTGCATCACTACGTGTAACAACAGCTCTTTTTTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31645
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113910 Nonsense 818 1108 19 24
Genomic Location (Zv9):
Chromosome 8 (position 20847797)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20277694
GRCz11 8 20309779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAATGTGTGGCAGGTCTTGGTCCGTGAAGAGAATCCAGGAATTCTATA[T/A]CGATTCAACCCTCCAGTCAGCAGAGATCCTCTGAGCAGTTACTCTTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7130
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113910 Nonsense 1062 1108 23 24
Genomic Location (Zv9):
Chromosome 8 (position 20839202)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20269099
GRCz11 8 20301184
KASP Assay ID:
554-4688.1 (used for ordering genotyping assays)
KASP Sequence:
TGCCCTGAGTCTCATCGTCCAGCCTTCATGCAGCAGTGCAAGAGCAAGTG[C/A]GACCACAGCGGCCCTACAGACAACCCTGAAGGTCAGAGGTCAAACAAAAG
Associated Phenotype:
Not determined