Busch Lab

ZMP

igdcc3

Ensembl ID:
ENSDARG00000075158
ZFIN ID:
ZDB-GENE-080303-24
Description:
immunoglobulin superfamily, DCC subclass, member 3 [Source:RefSeq peptide;Acc:NP_001091714]
Human Orthologue:
IGDCC3
Human Description:
immunoglobulin superfamily, DCC subclass, member 3 [Source:HGNC Symbol;Acc:9700]
Mouse Orthologue:
Igdcc3
Mouse Description:
immunoglobulin superfamily, DCC subclass, member 3 Gene [Source:MGI Symbol;Acc:MGI:1202390]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34100 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34099 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34100
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111388 Essential Splice Site 315 773 6 14
Genomic Location (Zv9):
Chromosome 7 (position 32864673)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31259013
GRCz11 7 31530163
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGGAACACGAGTGCGCAGAACTGCTCAGGGACTCCTAGTTGTGCAAGG[T/C]GAGGCTTTTTGGGTACAAAACTATGAACTTAATATTTGTCTATTGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111388 Nonsense 636 773 12 14
Genomic Location (Zv9):
Chromosome 7 (position 32839201)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31233541
GRCz11 7 31504691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGCTCCACCACAGGCATCATCATCGGCATCCACATAGGAGTCACTTG[C/A]ATCATTTTCTGTGTCCTATTCCTCATGTTCAGCTACAGGGGCAGGTGAGA
Associated Phenotype:
Not determined