Busch Lab

ZMP

si:ch211-222g23.4

Ensembl ID:
ENSDARG00000075156
ZFIN ID:
ZDB-GENE-070912-210
Human Orthologue:
TBC1D4
Human Description:
TBC1 domain family, member 4 [Source:HGNC Symbol;Acc:19165]
Mouse Orthologue:
Tbc1d4
Mouse Description:
TBC1 domain family, member 4 Gene [Source:MGI Symbol;Acc:MGI:2429660]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34676 Nonsense Available for shipment Available now
sa7334 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13545 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34676
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109137 Nonsense 227 1246 2 20
ENSDART00000143766 Nonsense 211 1230 2 20
ENSDART00000147813 None None 202 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31633005)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30788951
GRCz11 9 30599697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAATGGGCAGCGGAACTCCACTGAAGCCCCTGTGGAGTTTATTATGGGC[G/T]AGGATCCGTTAAGTTCATCCCTCTGTGAAGTGGATGAACCAGAATCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7334
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109137 Essential Splice Site 556 1246 9 20
ENSDART00000143766 Essential Splice Site 540 1230 9 20
ENSDART00000147813 None None 202 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31644043)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30799989
GRCz11 9 30610735
KASP Assay ID:
554-4449.1 (used for ordering genotyping assays)
KASP Sequence:
ACAAGTGYATTGSTTTTGTTTTCACTAGTTMATTTCATTGTTTGTTCYCT[A/G]GGGGGCGAGCCGTATGCGAAWGCGCCTGGGCAGCATGGGTAGTTTTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13545
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109137 Nonsense 809 1246 13 20
ENSDART00000143766 Nonsense 793 1230 13 20
ENSDART00000147813 None None 202 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31657350)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30813296
GRCz11 9 30624042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAAGCCATCCACCAACAAATTCTGCTCATCAGAATGGAGAAGGAGAAC[C/T]AGCRCCTGGAAGGTCAGTTATTCTCTTTTTTATTTATTTACATTTGTTTC
Associated Phenotype:
Not determined