Busch Lab

ZMP

zgc:165534

Ensembl ID:
ENSDARG00000075149
ZFIN ID:
ZDB-GENE-070928-4
Description:
hypothetical protein LOC569719 [Source:RefSeq peptide;Acc:NP_001103185]
Human Orthologue:
NAGPA
Human Description:
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase [Source:HGNC Symbol;Acc:17378]
Mouse Orthologue:
Nagpa
Mouse Description:
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36220 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36221 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36220
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126129 Essential Splice Site 190 586 2 11
Genomic Location (Zv9):
Chromosome 16 (position 43184267)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40567717
GRCz11 16 40517749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCAAAACGCTCAGTTTGGCATCAGAAAAGATGGGACACTGGTGTTTGG[G/A]TAAGCACGCAGCCCACAGTCTCTCTCTCTCTGCAGTCTTTCCCTCAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36221
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126129 Essential Splice Site 399 586 8 11
Genomic Location (Zv9):
Chromosome 16 (position 43196523)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40579973
GRCz11 16 40530005
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGAAGTGCCGTCAGACTTCTACGTTGAACTGTCTGTGTGTATGTTTGC[A/T]GTATGCACAGCAGGTTTGTATGGCGATGGCTGCAATCAGACATGCACATG
Associated Phenotype:
Not determined