Busch Lab

ZMP

BAI1 (2 of 3)

Ensembl ID:
ENSDARG00000075133
Description:
brain-specific angiogenesis inhibitor 1 [Source:HGNC Symbol;Acc:943]
Human Orthologue:
BAI1
Human Description:
brain-specific angiogenesis inhibitor 1 [Source:HGNC Symbol;Acc:943]
Mouse Orthologue:
Bai1
Mouse Description:
brain-specific angiogenesis inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1933736]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa14551 Nonsense Available for shipment Available now
sa15683 Nonsense Available for shipment Available now
sa22905 Essential Splice Site Available for shipment Available now
sa36209 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa28704 Nonsense Mutation detected in F1 DNA Not yet available
sa25026 Nonsense Mutation detected in F1 DNA Not yet available
sa42780 Nonsense Mutation detected in F1 DNA Not yet available
sa42781 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12101 Nonsense Available for shipment Available now
sa44857 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14551
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 74 767 1 12
Genomic Location (Zv9):
Chromosome 16 (position 38935212)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37570975
GRCz11 16 37521007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCAGCATGCCCTGCACCTGGACCCTACAGAACCCTGATCCACGGCGCTA[C/A]ACCATCTTCATCAAAGTCACAAAACCAACTAGAGACTGCATTGCCCGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15683
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 217 767 1 12
Genomic Location (Zv9):
Chromosome 16 (position 38935639)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37571402
GRCz11 16 37521434
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCAATGCTGGGACCAGCCTCCACTAGACAAAGAMTCCAATGGATGCTAT[C/T]GAGATGGGGTCTTTCTGGAAAACTGCAYCCCTGTTGTGAAAGAAGGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22905
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Essential Splice Site 240 767 1 12
Genomic Location (Zv9):
Chromosome 16 (position 38935710)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37571473
GRCz11 16 37521505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGCATCCCTGTTGTGAAAGAAGGAGCGTCTGAAACTGACAATAGCGG[T/A]AAGACAGTTTTGTCTAGTTATAATTCAGCATGGTTTGATTGTTATTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36209
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Essential Splice Site 293 767 2 12
Genomic Location (Zv9):
Chromosome 16 (position 38957112)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37593202
GRCz11 16 37543234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGGTGTTCTGGAAGAAGGTCGTCCATGCAATGCTCAGCCCTGCATCGG[T/G]AAGTGTCAGACTAAATATATGCACGCATGTGACCGTTTACATATTCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28704
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 304 767 3 12
Genomic Location (Zv9):
Chromosome 16 (position 38960184)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37596274
GRCz11 16 37546306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCATTGGACCCATAGGCTACAGGCAGTATTCCTCAAAAGGCCAGGGTT[T/A]AAGTCCAGTGAAATACAAAGGAATGCAAGAGGCCATGCTTGGTAAGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25026
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 375 767 5 12
Genomic Location (Zv9):
Chromosome 16 (position 38963289)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37599379
GRCz11 16 37549411
KASP Assay ID:
554-7737.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGGAGTGGTCTGCGTGGAGCGTGTGTTCGGCCACGTGTGGTGAGGGCT[G/A]GCAGAGCCGCACACGCTTCTGCGTCTCCGTGTCGTACAGCACGCAGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42780
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 543 767 7 12
Genomic Location (Zv9):
Chromosome 16 (position 38966848)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37602938
GRCz11 16 37552970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCACTTGGTCTGGTTGCACCAAAACCTGTGGTGGAGGAAGTCAGCAG[A/T]GACAGAGGCTGTGTTATGGTCCCTTTTTTGGGGGAGAGGCATGCCCGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42781
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Essential Splice Site 608 767 9 12
Genomic Location (Zv9):
Chromosome 16 (position 38968382)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37604470
GRCz11 16 37554502
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACCAATCCTCATAATAGATTTGGTAATCATGTCTTACATCTGTGATGC[A/T]GGATTAATTCTACGGCGATGTTCATTAGACAATGAGGGTATAGCATACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12101
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 624 767 9 12
Genomic Location (Zv9):
Chromosome 16 (position 38968433)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37604521
GRCz11 16 37554553
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGATTAATTCTACGGCGATGTTCATTAGACAATGAGGGTAKAGCATACTG[G/A]GAGARCCCAACATAWATGAAGTGCGTCTCAAATGATTACAGAAGTATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44857
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Essential Splice Site 708 767 10 12
Genomic Location (Zv9):
Chromosome 16 (position 38968774)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37604862
GRCz11 16 37554894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGATATTTAGGAGATCCTACTACAGCCCCAGTAATGCAGACATGAGG[G/A]TTAGTGTGGTATTATGTGCTTATGGAAAGGTGCTATAGAATGAATAGCTG
Associated Phenotype:
Not determined