Busch Lab

ZMP

hbegfa

Ensembl ID:
ENSDARG00000075121
ZFIN ID:
ZDB-GENE-080204-119
Description:
heparin-binding EGF-like growth factor [Source:RefSeq peptide;Acc:NP_001104696]
Human Orthologue:
HBEGF
Human Description:
heparin-binding EGF-like growth factor [Source:HGNC Symbol;Acc:3059]
Mouse Orthologue:
Hbegf
Mouse Description:
heparin-binding EGF-like growth factor Gene [Source:MGI Symbol;Acc:MGI:96070]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31972 Nonsense Available for shipment Available now
sa18135 Nonsense Available for shipment Available now
sa42344 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31972
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109138 Nonsense 64 230 2 6
Genomic Location (Zv9):
Chromosome 14 (position 7016163)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6743131
GRCz11 14 7049858
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTACCGTGGACAACAAGCTTGTGGAATATGAGGAGGAGGATGAAGAGTA[T/A]TACTATGATGATGATGTTGAAGAAGACGAGGAGGATGAGTTCTCTGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18135
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109138 Nonsense 135 230 3 6
Genomic Location (Zv9):
Chromosome 14 (position 7016457)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6743425
GRCz11 14 7050152
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAAAGGAAAGGGAAAAGGCAAGAAAAGAAACCCCTGTCTAAAAAAGTAC[A/T]AGGACTTTTGCATCCACGGAACCTGCCAGTACTTYAGGGATTTAAAGGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28259
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109138 Nonsense 161 230 4 6
Genomic Location (Zv9):
Chromosome 14 (position 7016624)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6743592
GRCz11 14 7050319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGACTGAAATGCTTTCCATTTCTTCCCACAGATGTGACCAGGGGTACT[C/A]AGGAGAGCGATGTCACGATTTCTCTCTGCCGGTGAAGACGAATGACGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42344
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109138 Nonsense 195 230 4 6
Genomic Location (Zv9):
Chromosome 14 (position 7016726)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6743694
GRCz11 14 7050421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATGACCGCACTACAGCCCTTGCTGTGGTAGCTGTGGTTCTCTCTTCAT[T/G]ATGTCTGACCATCATTGGCCTCCTCCTGGCACTCAGGTTTGTTTTTAAAC
Associated Phenotype:
Not determined