Busch Lab

ZMP

zgc:171531

Ensembl ID:
ENSDARG00000075107
ZFIN ID:
ZDB-GENE-030131-6336
Description:
NK2 homeobox 4 isoform 1 [Source:RefSeq peptide;Acc:NP_001104636]
Human Orthologue:
NKX2-1
Human Description:
NK2 homeobox 1 [Source:HGNC Symbol;Acc:11825]
Mouse Orthologue:
Nkx2-1
Mouse Description:
NK2 homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:108067]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42985 Nonsense Mutation detected in F1 DNA Not yet available
sa32169 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42985
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110871 Nonsense 229 345 2 2
Genomic Location (Zv9):
Chromosome 17 (position 42211780)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42107190
GRCz11 17 42096064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTACAAGATGAAGCGACAGGCCAAGGACAAAGCAGCGCAGCAGCTTCAA[C/T]AGGAGGGCAACCTGTGTCAACAACAGCAGTCGCCGAGGAGAGTGGCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32169
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110871 Nonsense 270 345 2 2
Genomic Location (Zv9):
Chromosome 17 (position 42211657)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42107067
GRCz11 17 42095941
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCTTGCCAAAACGGTTCCAACACGCCGACGCCAAACCAACAGCAAATG[C/T]AGCAGCAGCAGAACGGAGGAGGGGTCGTGCTTCCTACCTCGAGCAATTCT
Associated Phenotype:
Not determined